text2genome

About us

Related Links

Press Coverage

PubMed: 11522838    PubMedCentral: PMC55886

Determination of optimal sites of antisense oligonucleotide cleavage within TNFalpha mRNA.

Lloyd BH, Giles RV, Spiller DG, Grzybowski J, Tidd DM, Sibson DR
Nucleic acids research, 3664 , 2001

Abstract:

Antisense oligonucleotides provide a powerful tool in order to determine the consequences of the reduced expression of a selected target gene and may include target validation and therapeutic applications. Methods of predicting optimum antisense sites are not always effective. We have compared the efficacy of antisense oligonucleotides, which were selected in vitro using random combinatorial oligonucleotide libraries of differing length and complexity, upon putative target sites within TNFalpha mRNA. The relationship of specific target site accessibility and oligonucleotide efficacy with respect to these parameters proved to be complex. Modification of the length of the recognition sequence of the oligonucleotide library illustrated that independent target sites demonstrated a preference for antisense oligonucleotides of a defined and independent optimal length. The efficacy of antisense oligonucleotide sequences selected in vitro paralleled that observed in phorbol 12-myristate 13-acetate (PMA)-activated U937 cells. The application of methylphosphonate:phosphodiester chimaeric oligonucleotides to U937 cells reduced mRNA levels to up to 19.8% that of the untreated cell population. This approach provides a predictive means to profile any mRNA of known sequence with respect to the identification and optimisation of sites accessible to antisense oligonucleotide activity.

Organism/Genes in external databases

Datasource Data
Species found in fulltext (Linnaeus)
Homo sapiens
Rattus norvegicus
Cucumber mosaic virus
Human immunodeficiency virus 1
Hepatitis C virus
Human immunodeficiency virus
Escherichia coli
Mus musculus
Genes found in fulltext (GNAT)
EntrezGene:23047/PDS5B
EntrezGene:26227/PHGDH
EntrezGene:3251/HPRT1
EntrezGene:3778/KCNMA1
EntrezGene:3815/KIT
EntrezGene:57120/GOPC
EntrezGene:5729/PTGDR
EntrezGene:7462/LAT2

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TNF ENSG00000206439 2,3,5
TNF ENSG00000223952 2,3,5
TNF ENSG00000228321 2,3,5
TNF ENSG00000228849 2,3,5
TNF ENSG00000230108 2,3,5
TNF ENSG00000232810 2,3,5
TNF ENSG00000204490 5,2,3

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
2, 3, 5 HSCHR6_MHC_MCF:31619821-31622152
2, 3, 5 HSCHR6_MHC_QBL:31533753-31536086
2, 3, 5 HSCHR6_MHC_COX:31530924-31533255
2, 3, 5 chr6:31543512-31545843
2, 3, 5 HSCHR6_MHC_MANN:31582999-31585330
2, 3, 5 HSCHR6_MHC_SSTO:31533455-31535786
2, 3, 5 HSCHR6_MHC_DBB:31525656-31527987

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC55886.pdf CATCATCATCATCATTTCTGCTCTAAAAGCTGCTG
1 PMC55886.pdf CTACTACTACTACCTAAGCAACCTTAATTTCTCG
2 PMC55886.pdf CTTTTTGAGCCAGAAGAGGT
3 PMC55886.pdf ATACCCCGGTCTCCCAAATA
4 PMC55886.pdf GTAGGCCGATTACAGACACA
5 PMC55886.pdf CTTTCAGTGCTCATGGTGTC
6 PMC55886.pdf TGGAGAAGACCGAGTTTTTC
7 PMC55886.pdf ATAAACCCTCTGGCCCCATA
8 PMC55886.pdf ACACAGACATTAGCCGGATG
9 PMC55886.pdf CTGTGGTACTCGTGACTTTC
Display recognized sequences in FASTA format