text2genome

About us

Related Links

Press Coverage

PubMed: 16891822    PubMedCentral: PMC2729900

Upregulation of proinflammatory cytokines in the fetal brain of the Gaucher mouse.

Hong YB, Kim EY, Jung SC
Journal of Korean medical science, 733 , 2006

Abstract:

Gaucher disease is caused by a deficiency of glucocerebrosidase. Patients with Gaucher disease are divided into three major phenotypes: chronic nonneuronopathic, acute neuronopathic, and chronic neuronopathic, based on symptoms of the nervous system, the severity of symptoms, and the age of disease onset. The characteristics of patients with acute neuronopathic- and chronic neuronopathic-type Gaucher disease include oculomotor abnormalities, bulbar signs, limb rigidity, seizures and occasional choreoathetoid movements, and neuronal loss. However, the mechanisms leading to the neurodegeneration of this disorder remain unknown. To investigate brain dysfunction in Gaucher disease, we studied the possible role of inflammation in neurodegeneration during development of Gaucher disease in a mouse model. Elevated levels of the proinflammatory cytokines, IL-1alpha, IL-1beta, IL-6, and TNF-alpha, were detected in the fetal brains of Gaucher mice. Moreover, the levels of secreted nitric oxide and reactive oxygen species in the brains of Gaucher mice were higher than in wild-type mice. Thus, accumulated glucocerebroside or glucosylsphingosine, caused by glucocerebrosidase deficiency, may mediate brain inflammation in the Gaucher mouse via the elevation of proinflammatory cytokines, nitric oxide, and reactive oxygen species.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:14466/Gba
EntrezGene:16153/Il10
EntrezGene:16183/Il2
EntrezGene:16189/Il4
EntrezGene:16191/Il5
EntrezGene:16193/Il6
EntrezGene:21926/Tnf

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Il6 ENSMUSG00000025746 0,1
Tnf ENSMUSG00000024401 2,3
Actb ENSMUSG00000029580 5,4
Il1a ENSMUSG00000027399 6,7
Il1b ENSMUSG00000027398 8,9

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
2, 3 chr17:35337121-35337445
0, 1 chr5:30340067-30345962
8, 9 chr2:129191766-129193811
4, 5 chr16:37883074-37883606
4, 5 chr5:143665592-143666346
6, 7 chr2:129126491-129130515

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2729900.pdf GTTCTCTGGGAAATCGTGGA
1 PMC2729900.pdf GGAAATTGGGGTAGGAAGGA
2 PMC2729900.pdf ACGGCATGGATCTCAAAGAC
3 PMC2729900.pdf CGGACTCCGCAAAGTCTAAG
4 PMC2729900.pdf CCCACACTGTGCCCATCTAC
5 PMC2729900.pdf AGTACTTGCGCTCAGGAGGA
6 PMC2729900.pdf CGTCAGGCAGAAGTTTGTCA
7 PMC2729900.pdf GTGCACCCGACTTTGTTCTT
8 PMC2729900.pdf CAGGCAGGCAGTATCACTCA
9 PMC2729900.pdf AGGCCACAGGTATTTTGTCG
Display recognized sequences in FASTA format