text2genome

About us

Related Links

Press Coverage

PubMed: 20388199    PubMedCentral: PMC2873280

Generation of anti-TLR2 intrabody mediating inhibition of macrophage surface TLR2 expression and TLR2-driven cell activation.

Kirschning CJ, Dreher S, Maass B, Fichte S, Schade J, Köster M, Noack A, Lindenmaier W, Wagner H, Böldicke T
BMC biotechnology, 31 , 2010

Abstract:

BACKGROUND: Toll-like receptor (TLR) 2 is a component of the innate immune system and senses specific pathogen associated molecular patterns (PAMPs) of both microbial and viral origin. Cell activation via TLR2 and other pattern recognition receptors (PRRs) contributes to sepsis pathology and chronic inflammation both relying on overamplification of an immune response. Intracellular antibodies expressed and retained inside the endoplasmatic reticulum (ER-intrabodies) are applied to block translocation of secreted and cell surface molecules from the ER to the cell surface resulting in functional inhibition of the target protein. Here we describe generation and application of a functional anti-TLR2 ER intrabody (alphaT2ib) which was generated from an antagonistic monoclonal antibody (mAb) towards human and murine TLR2 (T2.5) to inhibit the function of TLR2. alphaT2ib is a scFv fragment comprising the variable domain of the heavy chain and the variable domain of the light chain of mAb T2.5 linked together by a synthetic (Gly4Ser)3 amino acid sequence. RESULTS: Coexpression of alphaT2ib and mouse TLR2 in HEK293 cells led to efficient retention and accumulation of TLR2 inside the ER compartment. Co-immunoprecipitation of human TLR2 with alphaT2ib indicated interaction of alphaT2ib with its cognate antigen within cells. alphaT2ib inhibited NF-kappaB driven reporter gene activation via TLR2 but not through TLR3, TLR4, or TLR9 if coexpressed in HEK293 cells. Co-transfection of human TLR2 with increasing amounts of the expression plasmid encoding alphaT2ib into HEK293 cells demonstrated high efficiency of the TLR2-alphaT2ib interaction. The alphaT2ib open reading frame was integrated into an adenoviral cosmid vector for production of recombinant adenovirus (AdV)-alphaT2ib. Transduction with AdValphaT2ib specifically inhibited TLR2 surface expression of murine RAW264.7 and primary macrophages derived from bone marrow (BMM). Furthermore, TLR2 activation dependent TNFalpha mRNA accumulation, as well as TNFalpha translation and release by macrophages were largely abrogated upon transduction of alphaT2ib. alphaT2ib was expressed in BMM and splenocytes over 6 days upon systemic infection with AdValphaT2ib. Systemic transduction applying AdValphaT2ib rendered immune cells largely non-responsive to tripalmitoyl-peptide challenge. Our results show persistent paralysis of TLR2 activity and thus inhibition of immune activation. CONCLUSION: The generated anti-TLR2 scFv intrabody inhibits specifically and very efficiently TLR2 ligand-driven cell activation in vitro and ex vivo. This indicates a therapeutic potential of alphaT2ib in microbial or viral infections.

Organism/Genes in external databases

Datasource Data

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Tnf ENSMUSG00000024401 6,7
Il6 ENSMUSG00000025746 8,9

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
3 chr12:114667992-114668016
9 chr5:30346064-30346085
10 chrX:50374289-50374309
2 chr6:70672571-70672594
6, 7 chr17:35337090-35338785

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2873280.pdf TGAGGAGACGGTGACCGTGGTCCCTTGGCCCC
1 PMC2873280.pdf GACATTGAGCTCACCCAGTCTCCA
2 PMC2873280.pdf CCGTTTGATTTCCAGCTTGGTGCC
3 PMC2873280.pdf GGCACCACGGTCACCGTCTCCTCA
4 PMC2873280.pdf TGGAGACTGAGTGAGCTCGATGTC
5 PMC2873280.pdf AATTGCGGCCGCCATGGCCGC
6 PMC2873280.pdf ATGAGCACAGAAAGCATGATC
7 PMC2873280.pdf CACAGAGCAATGACTCCAAAG
8 PMC2873280.pdf ATGAAGTTCCTCTCTGCAAGA
9 PMC2873280.pdf GGTTTGCCGAGTAGATCTCAA
10 PMC2873280.pdf ATTCAACTTGCGCTCATCTT
Display recognized sequences in FASTA format