text2genome

About us

Related Links

Press Coverage

PubMed: 18519647    PubMedCentral: PMC2413041

A crucial role for HVEM and BTLA in preventing intestinal inflammation.

Steinberg MW, Turovskaya O, Shaikh RB, Kim G, McCole DF, Pfeffer K, Murphy KM, Ware CF, Kronenberg M
The Journal of experimental medicine, 1463 , 2008

Abstract:

The interaction between the tumor necrosis factor (TNF) family member LIGHT and the TNF family receptor herpes virus entry mediator (HVEM) co-stimulates T cells and promotes inflammation. However, HVEM also triggers inhibitory signals by acting as a ligand that binds to B and T lymphocyte attenuator (BTLA), an immunoglobulin super family member. The contribution of HVEM interacting with these two binding partners in inflammatory processes remains unknown. In this study, we investigated the role of HVEM in the development of colitis induced by the transfer of CD4(+)CD45RB(high) T cells into recombination activating gene (Rag)(-/-) mice. Although the absence of HVEM on the donor T cells led to a slight decrease in pathogenesis, surprisingly, the absence of HVEM in the Rag(-/-) recipients led to the opposite effect, a dramatic acceleration of intestinal inflammation. Furthermore, the critical role of HVEM in preventing colitis acceleration mainly involved HVEM expression by radioresistant cells in the Rag(-/-) recipients interacting with BTLA. Our experiments emphasize the antiinflammatory role of HVEM and the importance of HVEM expression by innate immune cells in preventing runaway inflammation in the intestine.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:19373/Rag1
EntrezGene:50930/Tnfsf14
EntrezGene:208154/Btla
EntrezGene:230979/Tnfrsf14
Species found in fulltext (Linnaeus)
Mus musculus
Homo sapiens
Mus sp.
Citrobacter rodentium
Rattus norvegicus
Neovison vison
Morchella esculenta
Genes found in fulltext (GNAT)
EntrezGene:11126/CD160
EntrezGene:12504/Cd4
EntrezGene:12519/Cd80
EntrezGene:14131/Fcgr3
EntrezGene:16153/Il10
EntrezGene:16159/Il12a
EntrezGene:16171/Il17a
EntrezGene:16183/Il2
EntrezGene:16189/Il4
EntrezGene:16409/Itgam
EntrezGene:16411/Itgax
EntrezGene:19264/Ptprc
EntrezGene:21926/Tnf
EntrezGene:230979/Tnfrsf14
EntrezGene:24699/CD45_RAT
EntrezGene:29126/CD274
EntrezGene:3439/IFNA1
EntrezGene:3558/IL2
EntrezGene:3559/IL2RA
EntrezGene:3565/IL4
EntrezGene:3586/IL10
EntrezGene:3605/IL17A
EntrezGene:3684/ITGAM
EntrezGene:5045/FURIN
EntrezGene:50930/Tnfsf14
EntrezGene:54215/Cd160
EntrezGene:5788/PTPRC
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:83430/Il23a
EntrezGene:8740/TNFSF14
EntrezGene:8764/TNFRSF14
EntrezGene:920/CD4
EntrezGene:942/CD86
EntrezGene:958/CD40
EntrezGene:970/CD70

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Tnf ENSMUSG00000024401 0,1
Ifng ENSMUSG00000055170 2,3
Il4 ENSMUSG00000000869 4,5
Il17a ENSMUSG00000025929 6,7
Il23a ENSMUSG00000025383 10,11
Il10 ENSMUSG00000016529 12,13
Tgfb1 ENSMUSG00000002603 14,15

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
2, 3 chr10:117879518-117879697
16 chr13:105221273-105221293
16 chr3:69521155-69521175
9 chr3:68499156-68499179
14, 15 chr7:26479318-26482194
16 chr6:115757121-115757141
16 chr8:4391865-4391885
5 chr11:53427523-53427544
6, 7 chr1:20722292-20724006
0, 1 chr17:35337378-35337847
16 chr3:157551678-157551698
12, 13 chr1:132917914-132919112
16 chr17:74731710-74731730
11 chr10:127734150-127734175

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2413041.pdf CATCTTCTCAAAATTCGAGTGACAA
1 PMC2413041.pdf TGGGAGTAGACAAGGTACAACCC
2 PMC2413041.pdf TCAAGTGGCATAGATGTGGAAGAA
3 PMC2413041.pdf TGGCTCTGCAGGATTTTCATG
4 PMC2413041.pdf ACAGGAGAAGGGACGCCAT
5 PMC2413041.pdf GAAGCCCTACAGACGAGCTCA
6 PMC2413041.pdf GGTCAACCTCAAAGTCTTTAACTC
7 PMC2413041.pdf TTAAAAATGCAAGTAAGTTTGCTG
8 PMC2413041.pdf TGAAGACGGCCAGAGAAAAAC
9 PMC2413041.pdf AAGGAACCCTTAGAGTGCTTACT
10 PMC2413041.pdf AGCGGGACATATGAATCTACTAAGAGA
11 PMC2413041.pdf GTCCTAGTAGGGAGGTGTGAAGTTG
12 PMC2413041.pdf GGTTGCCAAGCCTTATCGGA
13 PMC2413041.pdf ACCTGCTCCACTGCCTTGCT
14 PMC2413041.pdf TGACGTCACTGGAGTTGTACGG
15 PMC2413041.pdf GGTTCATGTCATGGATGGTGC
16 PMC2413041.pdf GGATCTGGCCCTTGAACCTT
Display recognized sequences in FASTA format