text2genome

About us

Related Links

Press Coverage

PubMed: 3060862    PubMedCentral: PMC339034

Nucleotide sequence of a cDNA encoding the rat p53 nuclear oncoprotein.

Soussi T, Caron de Fromentel C, Breugnot C, May E
Nucleic acids research, 11384 , 1988

Abstract:

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:24842/P53_RAT
Genes found in fulltext (GNAT)
EntrezGene:22059/Trp53
EntrezGene:2678/GGT1
EntrezGene:31/ACACA
EntrezGene:4350/MPG
EntrezGene:7368/UGT8
EntrezGene:788/SLC25A20
EntrezGene:847/CAT

Best predicted genome from sequences: Rattus norvegicus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
P53_RAT ENSRNOG00000010756 0,1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
1, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 21, 22, 23 chr10:56406569-56411128
0 chr2:207500630-207500653
0 chr9:20158679-20158702

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC339034.txt cccctgaagactggataactgtc
1 PMC339034.txt GAGGATTCACAGTCGGATATGAGCATCGAGCTCCCTCTGAGTCAGGAG
2 PMC339034.txt ACATTTTCATGCTTATGGAAACTT
3 PMC339034.txt CCTCCAGATGATATTCTGCCCACCACAGCGACAGGGTCACCTT
4 PMC339034.txt GATCTGTTCCTGCCCCAGGATGTTGCAGAGTTGTTAGAAGGCCCAGAGGAAGCCCTC
5 PMC339034.txt CAAGTGTCAGCTCCTGCAGCACAGGAACCTGGAACTGAGGCCCCTGCACCCGTGGCCCCTGCTTCAGCT
6 PMC339034.txt ACACCGTGGCCTCTGTCATCTTCCGTCCCTTCTCAAAAAACTTACCAAGGCAACTATGGCTTCCACCTGT
7 PMC339034.txt GGCTTCCTGCAGTCAGGGACA
8 PMC339034.txt AAGTCTGTTATGTGCACGTACTCAATTTCCCTCAATAAGCTGTTCG
9 PMC339034.txt CAGCTGGCGAAGACATGCCCTGTGCAGTTGTGGGTCACCTCCACACCTCCACCTGGTACCCGTGTCC
10 PMC339034.txt CGTGCCATGGCCATCTACAAGAAGTCACAACACATGACTGAGGTCGTGAGACGCTGCCCCCACCATGAG
11 PMC339034.txt CTGGCTCCTCCCCAACATCTTATCCGGGTGGAAGGAAATCCGTATGCT
12 PMC339034.txt TATCTGGACGACAGGCAGACTTTTCGGCACAGCGTG
13 PMC339034.txt GTACCGTATGAGCCACCTGAGGTCGGC
14 PMC339034.txt ACTATCCACTACAAGTACATGTGCAACAGCTCCTGCATGGGGGGCATGAACCGC
15 PMC339034.txt ATCATCACGCTGGAAGACTCCAGTGGGAATCTTCTGGGACGGGACAGCTTTGAGGTT
16 PMC339034.txt CGTGTTTGTGCCTGTCCTGGGAGAGACCGTCGGACAGAGGAAGAAAATTTCCCCAAAAAAGAAGAGCAT
17 PMC339034.txt TGCCCGGAGCTGCCCCCAGGG
18 PMC339034.txt GCAAAGAGAGCACTGCCCACCAGCACAAGCTCCTCTCCCCAGCAAC
19 PMC339034.txt TATTTCACCCTTAAGATCCGTGGGCGTGAGCGCTTCGAGATGTTC
20 PMC339034.txt TTAAAGGATGCCCGTGCTGCCGAGGAGTCAGGAGACAGCAGGGCT
21 PMC339034.txt CAGTCTACGTCCCGCCATAAAAAACCAATGATCAAG
22 PMC339034.txt cagactctgcatcctgtccccatcaccagcctccccgtcccctcctttcttgccattttatgact
23 PMC339034.txt ttagcttgttatgagagctgacaagacaatgctagtcccttcactgcctttttttaccttgtagatagtactcggccccctctatgcaaactggttcctggcccagattggggaatgggttggtagttgctgggtctctgctggtccagcaaatcGtatccggtcagttgttggacctggcacGtacagtgaaatttcaccccaccccaccggctgtaagattctatcttgggcGctcataGgatctgtatcctcaggaccGatttcctccactctgcaaagcctgtctgcatttatccatcccccacccctctccctctttttatctctttttatatatccaatttcttattttacaa
Display recognized sequences in FASTA format