text2genome

About us

Related Links

Press Coverage

PubMed: 17069461    PubMedCentral: PMC1626105

EC5S ubiquitin complex is recruited by KSHV latent antigen LANA for degradation of the VHL and p53 tumor suppressors.

Cai QL, Knight JS, Verma SC, Zald P, Robertson ES
PLoS pathogens, , 2006

Abstract:

Cellular protein degradation pathways can be utilized by viruses to establish an environment that favors their propagation. Here we report that the Kaposi's sarcoma-associated herpesvirus (KSHV)-encoded latency-associated nuclear antigen (LANA) directly functions as a component of the EC5S ubiquitin complex targeting the tumor suppressors von Hippel-Lindau (VHL) and p53 for degradation. We have characterized a suppressor of cytokine signaling box-like motif within LANA composed of an Elongin B and C box and a Cullin box, which is spatially located at its amino and carboxyl termini. This motif is necessary for LANA interaction with the Cul5-Elongin BC complex, to promote polyubiquitylation of cellular substrates VHL and p53 in vitro via its amino- and carboxyl-terminal binding domain, respectively. In transfected cells as well as KSHV-infected B lymphoma cells, LANA expression stimulates degradation of VHL and p53. Additionally, specific RNA interference-mediated LANA knockdown stabilized VHL and p53 in primary effusion lymphoma cells. Thus, manipulation of tumor suppressors by LANA potentially provides a favorable environment for progression of KSHV-infected tumor cells.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:7157/TP53
EntrezGene:7428/VHL
EntrezGene:8065/CUL5
EntrezGene:8453/CUL2
Genes found in fulltext (GNAT)
EntrezGene:10489/LRRC41
EntrezGene:1154/CISH
EntrezGene:1385/CREB1
EntrezGene:1387/CREBBP
EntrezGene:143384/C10orf46
EntrezGene:2597/GAPDH
EntrezGene:27224/Tceb3
EntrezGene:4193/MDM2
EntrezGene:4254/KITLG
EntrezGene:5925/RB1
EntrezGene:6500/SKP1
EntrezGene:6774/STAT3
EntrezGene:6921/TCEB1
EntrezGene:6923/TCEB2
EntrezGene:7157/TP53
EntrezGene:8065/CUL5
EntrezGene:8453/CUL2
EntrezGene:856061/ELC1
EntrezGene:8626/TP63
EntrezGene:9978/RBX1

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TP53 ENSG00000141510 3,4

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
3, 4 chr17:7573997-7577092
5 chr19:47062344-47062363
5 chr4:88128689-88128708
5 chr12:6646484-6646503
5 chr15:44647334-44647353
5 chr11:88141902-88141921
5 chr10:57427639-57427658
5 chrX:39646918-39646937
5 chr16:28251543-28251562

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC1626105.pdf GCTAGGCCACAACACATCT
1 PMC1626105.pdf ATGTGACTTCGCCAACCGTAG
2 PMC1626105.pdf TGCTTCTTCTGCAATCTCCG
3 PMC1626105.pdf CTCTCGGAACATCTCGAAGC
4 PMC1626105.pdf GCGCACAGAGGAAGAGAATC
5 PMC1626105.pdf TGCACCACCAACTGCTTAG
Display recognized sequences in FASTA format