text2genome

About us

Related Links

Press Coverage

PubMed: 19060952    PubMedCentral: PMC2586658

Allergen uptake, activation, and IL-23 production by pulmonary myeloid DCs drives airway hyperresponsiveness in asthma-susceptible mice.

Lewkowich IP, Lajoie S, Clark JR, Herman NS, Sproles AA, Wills-Karp M
PloS one, , 2008

Abstract:

Maladaptive, Th2-polarized inflammatory responses are integral to the pathogenesis of allergic asthma. As regulators of T cell activation, dendritic cells (DCs) are important mediators of allergic asthma, yet the precise signals which render endogenous DCs "pro-asthmatic", and the extent to which these signals are regulated by the pulmonary environment and host genetics, remains unclear. Comparative phenotypic and functional analysis of pulmonary DC populations in mice susceptible (A/J), or resistant (C3H) to experimental asthma, revealed that susceptibility to airway hyperresponsiveness is associated with preferential myeloid DC (mDC) allergen uptake, and production of Th17-skewing cytokines (IL-6, IL-23), whereas resistance is associated with increased allergen uptake by plasmacytoid DCs. Surprisingly, adoptive transfer of syngeneic HDM-pulsed bone marrow derived mDCs (BMDCs) to the lungs of C3H mice markedly enhanced lung IL-17A production, and rendered them susceptible to allergen-driven airway hyperresponsiveness. Characterization of these BMDCs revealed levels of antigen uptake, and Th17 promoting cytokine production similar to that observed in pulmonary mDCs from susceptible A/J mice. Collectively these data demonstrate that the lung environment present in asthma-resistant mice promotes robust pDC allergen uptake, activation, and limits Th17-skewing cytokine production responsible for driving pathologic T cell responses central to the development of allergen-induced airway hyperresponsiveness.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:83430/Il23a
Genes found in fulltext (GNAT)
EntrezGene:11488/Adam11
EntrezGene:12519/Cd80
EntrezGene:12524/Cd86
EntrezGene:12981/Csf2
EntrezGene:1437/CSF2
EntrezGene:15139/Hc
EntrezGene:16159/Il12a
EntrezGene:16163/Il13
EntrezGene:16171/Il17a
EntrezGene:16172/Il17ra
EntrezGene:16189/Il4
EntrezGene:16191/Il5
EntrezGene:16193/Il6
EntrezGene:17300/Foxc1
EntrezGene:1778/DYNC1H1
EntrezGene:20028/Pdc
EntrezGene:21898/Tlr4
EntrezGene:2237/FEN1
EntrezGene:23308/ICOSLG
EntrezGene:29126/CD274
EntrezGene:31/ACACA
EntrezGene:3565/IL4
EntrezGene:3567/IL5
EntrezGene:3569/IL6
EntrezGene:3586/IL10
EntrezGene:3596/IL13
EntrezGene:3684/ITGAM
EntrezGene:51561/IL23A
EntrezGene:5788/PTPRC
EntrezGene:5967/REG1A
EntrezGene:684/BST2
EntrezGene:7292/TNFSF4
EntrezGene:763/CA5A
EntrezGene:788/SLC25A20
EntrezGene:83430/Il23a
EntrezGene:920/CD4
EntrezGene:941/CD80
EntrezGene:942/CD86

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Il6 ENSMUSG00000025746 0,1
Il12b ENSMUSG00000004296 2,3
Il23a ENSMUSG00000025383 4,5
Il12a ENSMUSG00000027776 6,7
Tnf ENSMUSG00000024401 8,9
Tgfb1 ENSMUSG00000002603 10,11

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 1 chr5:30339956-30340056
8, 9 chr17:35337378-35337847
2, 3 chr11:44217547-44221335
10 chr7:26479253-26479273
4, 5 chr10:127734178-127734575
6, 7 chr3:68499460-68501869

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2586658.pdf ACAACCACGGCCTTCCCTAC
1 PMC2586658.pdf AGCCTCCGACTTGTGAAGTGG
2 PMC2586658.pdf CAGAAGCTAACCATCTCCTGG
3 PMC2586658.pdf AGTCCAGTCCACCTCTACAAC
4 PMC2586658.pdf GACCCACAAGGACTCAAGGA
5 PMC2586658.pdf CATGGGGCTATCAGGGAGTA
6 PMC2586658.pdf GCTTCTCCCACAGGAGGTTT
7 PMC2586658.pdf CTAGACAAGGGCATGCTGGT
8 PMC2586658.pdf CATCTTCTCAAAATTCGAGTGACAA
9 PMC2586658.pdf TGGGAGTAGACAAGGTACAACCC
10 PMC2586658.pdf AATTCCTGGCGTTACCTTGG
11 PMC2586658.pdf GGCTGATCCCGTTGATTTCC
Display recognized sequences in FASTA format