text2genome

About us

Related Links

Press Coverage

PubMed: 18394170    PubMedCentral: PMC2323389

Non-cell autonomous impairment of oligodendrocyte differentiation precedes CNS degeneration in the Zitter rat: implications of macrophage/microglial activation in the pathogenesis.

Sakakibara S, Nakadate K, Ookawara S, Ueda S
BMC neuroscience, 35 , 2008

Abstract:

BACKGROUND: The zitter (zi/zi) rat, a loss-of-function mutant of the glycosylated transmembrane protein attractin (atrn), exhibits widespread age-dependent spongiform degeneration, hypomyelination, and abnormal metabolism of reactive oxygen species (ROS) in the brain. To date, the mechanisms underlying these phenotypes have remained unclear. RESULTS: Here, we show differentiation defects in zi/zi oligodendrocytes, accompanied by aberrant extension of cell-processes and hypomyelination. Axonal bundles were relatively preserved during postnatal development. With increasing in age, the injured oligodendrocytes in zi/zi rats become pathological, as evidenced by the accumulation of iron in their cell bodies. Immunohistochemical analysis revealed that atrn expression was absent from an oligodendrocyte lineage, including A2B5-positive progenitors and CNPase-positive differentiated cells. The number and distribution of Olig2-positive oligodendrocyte progenitors was unchanged in the zi/zi brain. Furthermore, an in vitro differentiation assay of cultured oligodendrocyte progenitors prepared from zi/zi brains revealed their normal competence for proliferation and differentiation into mature oligodendrocytes. Interestingly, we demonstrated the accelerated recruitment of ED1-positive macrophages/microglia to the developing zi/zi brain parenchyma prior to the onset of hypomyelination. Semiquantitative RT-PCR analysis revealed a significant up-regulation of CD26 and IL1-beta in the zi/zi brain during this early postnatal stage. CONCLUSION: We demonstrated that the onset of the impairment of oligodendrocyte differentiation occurs in a non-cell autonomous manner in zi/zi rats. Hypomyelination of oligodendrocytes was not due to a failure of the intrinsic program of oligodendrocytes, but rather, was caused by extrinsic factors that interrupt oligodendrocyte development. It is likely that macrophage/microglial activation in the zi/zi CNS leads to disturbances in oligodendrocyte differentiation via deleterious extrinsic factors, such as the cytokine IL1-beta or ROS. Atrn might be involved in the activation of brain macrophages/microglia by suppressing excessive migration of monocytes into the CNS, or by accelerating the transformation of brain monocytes into resting microglia. Understanding the pathogenesis of the zi/zi rat may provide novel insights into the developmental interaction betweens macrophages/microglia and cells of an oligodendrocyte lineage.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:10215/OLIG2
EntrezGene:1803/DPP4
EntrezGene:24588/NFM_RAT
EntrezGene:2581/GALC
EntrezGene:2597/GAPDH
EntrezGene:2833/CXCR3
EntrezGene:2919/CXCL1
EntrezGene:2920/CXCL2
EntrezGene:3569/IL6
EntrezGene:4155/MBP
EntrezGene:5354/PLP1
EntrezGene:6347/CCL2
EntrezGene:6352/CCL5
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7852/CXCR4
EntrezGene:83526/ATRN_RAT
EntrezGene:8455/ATRN

Best predicted genome from sequences: Rattus norvegicus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
IL1B_RAT ENSRNOG00000004649 0,1
TNFA_RAT ENSRNOG00000000837 2,3
IFNG_RAT ENSRNOG00000007468 4,5
IL6_RAT ENSRNOG00000010278 6,7
TGFB1_RAT ENSRNOG00000020652 8,9
G3P_RAT ENSRNOG00000018630 10,11
CCL5_RAT ENSRNOG00000010906 12,13
CCL3_RAT ENSRNOG00000011205 14,15
CCL2_RAT ENSRNOG00000007159 16,17
CXCR4_RAT ENSRNOG00000003866 20,21
GROA_RAT ENSRNOG00000002802 24,25
DPP4_RAT ENSRNOG00000030763 27,26
CXCR3_RAT ENSRNOG00000003305 28,29

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
16, 17 chr10:70256385-70257767
10, 11 chr10:70056189-70056712
10, 11 chr18:70986211-70986732
10, 11 chr8:83288491-83289023
10, 11 chr10:79571923-79572451
10, 11 chr8:105552731-105553258
10, 11 chr8:44322022-44322550
10, 11 chr18:64975321-64975849
10, 11 chr5:8009000-8009529
10, 11 chr18:67744544-67745085
10, 11 chr7:124293827-124294342
10, 11 chr6:80063611-80064148
10, 11 chr4:25139724-25140256
10, 11 chr17:92015264-92015803
20, 21 chr13:41309645-41312160
13 chr10:71605848-71605868
10, 11 chr1:181632421-181632944
10, 11 chr8:53248619-53249095
10, 11 chr13:101148447-101148939
10, 11 chr5:73006417-73006945
7 chr4:457149-457174
10, 11 chr10:103408157-103408685
10, 11 chr5:100212866-100213381
10, 11 chr5:106673483-106674012
10, 11 chr2:231163732-231164221
14, 15 chr10:71744839-71746017
10, 11 chr14:1949570-1950097
10, 11 chr3:133100203-133100721
10, 11 chr4:123557946-123558450
10, 11 chr16:38281972-38282498
10, 11 chrX:93853134-93853661
10, 11 chrX:36765051-36765577
10, 11 chr11:70680056-70680584
23 chr4:153508988-153509009
10, 11 chr20:41291361-41291888
10, 11 chr16:25751493-25752021
10, 11 chrX:10020668-10021193
10, 11 chr4:2882869-2883397
10, 11 chrX:109757566-109758095
10, 11 chr5:11427477-11428003
10, 11 chr6:6990052-6990562
28, 29 chrX:89795514-89796854
26, 27 chr3:44308454-44312724
10, 11 chr1:180231949-180232475
10, 11 chr16:18713332-18713860
0, 1 chr3:116965896-116967826
10, 11 chr2:96278658-96279185
10, 11 chr7:121242485-121243011
11 chr5:130543704-130544477
10, 11 chr3:97329365-97329886
10, 11 chr18:49828305-49828835
3 chr20:3662492-3662513
10, 11 chr2:61255922-61256449
10, 11 chr3:53433760-53434288
10, 11 chr16:49700282-49700821
10, 11 chr3:146189379-146189902
10, 11 chr8:97831306-97831859
10, 11 chr4:132437729-132438256
10, 11 chr4:161282697-161283522
10, 11 chr18:16797173-16797708
18, 24, 25 chr14:18678892-18691869
4, 5 chr7:57621819-57625708
10, 11 chr2:13819901-13820429
10, 11 chr5:117080574-117081102
8, 9 chr1:80903059-80910223

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2323389.pdf CAAGCACCTTCTTTTCCTTCATC
1 PMC2323389.pdf GTCGTTGCTTGTCTCTCCTTGTA
2 PMC2323389.pdf CCCAGACCCTCACACTCAGAT
3 PMC2323389.pdf TTGTCCCTTGAAGAGAACCTG
4 PMC2323389.pdf GCCAAGGCACACTCATTGAA
5 PMC2323389.pdf GCTGGTGAATCACTCTGATG
6 PMC2323389.pdf CAAGAGACTTCCAGCCAGTTGC
7 PMC2323389.pdf TTGCCGAGTAGACCTCATAGTGACC
8 PMC2323389.pdf GAGAGCCCTGGATACCAACTACTG
9 PMC2323389.pdf GTGTGTCCAGGCTCCAAATGTAG
10 PMC2323389.pdf ACCACCATGGAGAAGGCTGG
11 PMC2323389.pdf CTCAGTGTAGCCCAGGATGC
12 PMC2323389.pdf CTCCAACCTTGCAGTCGTCT
13 PMC2323389.pdf GCCTGTGAAGAGCACACCTC
14 PMC2323389.pdf TGCTGTTCTTCTCTGCACCA
15 PMC2323389.pdf GGCTACTTGGCAGCAAACAG
16 PMC2323389.pdf TGTAGCATCCACGTGCTGTC
17 PMC2323389.pdf GCTTGAGGTGGTTGTGGAAA
18 PMC2323389.pdf TCAATGCCTGACGACCCTAC
19 PMC2323389.pdf ACTCAGACAGCGAGGCACAT
20 PMC2323389.pdf GTTTGGTGCTCCGGTAGCTA
21 PMC2323389.pdf CCAGAAGGGGAGTGTGATGA
22 PMC2323389.pdf GCTCTGCATCAGTGACGGTA
23 PMC2323389.pdf CTTTGTGCTGGCAAATCTCAG
24 PMC2323389.pdf AGACAGTGGCAGGGATTCAC
25 PMC2323389.pdf GAACGACCATCGATGAAACG
26 PMC2323389.pdf GCCTGGGTTTCAGAAGACAGA
27 PMC2323389.pdf CTGGAACTGGCAGATGTGTTTG
28 PMC2323389.pdf ACAAGTGCCAAAGGCAGAGAAG
29 PMC2323389.pdf GAGCAGGAAGGTGTCTGTGCT
Display recognized sequences in FASTA format