text2genome

About us

Related Links

Press Coverage

PubMed: 19337411    PubMedCentral: PMC2636579

Nanomembrane-driven co-elution and integration of active chemotherapeutic and anti-inflammatory agents.

Pierstorff E, Ho D
International journal of nanomedicine, 425 , 2008

Abstract:

The release of therapeutic drugs from the surface of implantable devices is instrumental for the reduction of medical costs and toxicity associated with systemic administration. In this study we demonstrate the triblock copolymer-mediated deposition and release of multiple therapeutics from a single thin film at the air-water interface via Langmuir-Blodgett deposition. The dual drug elution of dexamethasone (Dex) and doxorubicin hydrochloride (Dox) from the thin film is measured by response in the RAW 264.7 murine macrophage cell line. The integrated hydrophilic and hydrophobic components of the polymer structure allows for the creation of hybrids of the copolymer and the hydrophobic Dex and the hydrophilic Dox. Confirmation of drug release and functionality was demonstrated via suppression of the interleukin 6 (IL-6) and tumor necrosis factor alpha (TNFalpha) inflammatory cytokines (Dex), as well as TUNEL staining and DNA fragmentation analysis (Dox). The inherent biocompatibility of the copolymeric material is further demonstrated by the lack of inflammation and apoptosis induction in cells grown on the copolymer films. Thus a layer-by-layer anchored deposition of an anti-inflammatory and chemotherapeutic functionalized copolymer film is able to localize drug dosage to the surface of a medical device, all with an innate material thickness of 4 nm per layer.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:3569/IL6
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Tnf ENSMUSG00000024401 0,1
Il6 ENSMUSG00000025746 2,3
Actb ENSMUSG00000029580 4,5

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
2, 3 chr5:30340000-30340087
0, 1 chr17:35338616-35338700
4, 5 chr5:143665450-143665924

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2636579.pdf GGTGCCTATGTCTCAGCCTCTT
1 PMC2636579.pdf CGATCACCCCGAAGTTCAGT
2 PMC2636579.pdf CACAGAGGATACCACTCCCAACA
3 PMC2636579.pdf TCCACGATTTCCCAGAGAACA
4 PMC2636579.pdf TGGAATCCTGTGGCATCCATGAAAC
5 PMC2636579.pdf TAAAACGCAGCTCAGTAACAGTCCG
Display recognized sequences in FASTA format