text2genome

About us

Related Links

Press Coverage

PubMed: 2995927    PubMedCentral: PMC321958

Human lymphotoxin and tumor necrosis factor genes: structure, homology and chromosomal localization.

Nedwin GE, Naylor SL, Sakaguchi AY, Smith D, Jarrett-Nedwin J, Pennica D, Goeddel DV, Gray PW
Nucleic acids research, 6361 , 1985

Abstract:

Human Tumor Necrosis Factor and Lymphotoxin are cytotoxic proteins which have similar biological activities and share 30 percent amino acid homology. The single copy genes which encode these proteins share several structural features: each gene is approximately three kilobase pairs in length and is interrupted by three introns. In addition, these genes are closely linked and have been mapped to human chromosome 6. However, only the last exons of both genes, which code for more than 80 percent of each secreted protein, are significantly homologous (56 percent).

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:4049/LTA
EntrezGene:4049/LTA
EntrezGene:4049/LTA
EntrezGene:4050/LTB
EntrezGene:4050/LTB
EntrezGene:4050/LTB
EntrezGene:4050/LTB
EntrezGene:4050/LTB
EntrezGene:4050/LTB
EntrezGene:4050/LTB
EntrezGene:4050/LTB
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
Genes found in fulltext (GNAT)
EntrezGene:10249/GLYAT
EntrezGene:21926/Tnf
EntrezGene:2201/FBN2
EntrezGene:31/ACACA
EntrezGene:4049/LTA
EntrezGene:4049/LTA
EntrezGene:4049/LTA
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:788/SLC25A20

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TNF ENSG00000206439 18,19,26,27,28,29,30,31
TNF ENSG00000223952 18,19,26,27,28,29,30,31
TNF ENSG00000228321 18,19,26,27,28,29,30,31
TNF ENSG00000228849 18,19,26,27,28,29,30,31
TNF ENSG00000230108 18,19,26,27,28,29,30,31
TNF ENSG00000232810 18,19,26,27,28,29,30,31
TNF ENSG00000204490 26,27,28,29,30,31,18,19
LTA ENSG00000231408 37,3,39,4,41,5,8,9,10,11,14,33,35

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
3, 4, 5, 6, 7, 8, 9, 10, 11, 14, 16, 17, 18, 19, 21, 22, 23, 24, 26, 27, 28, 29, 30, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42 HSCHR6_MHC_MANN:31579239-31585792
3, 4, 5, 6, 7, 8, 9, 10, 11, 14, 16, 17, 18, 19, 21, 22, 23, 24, 26, 27, 28, 29, 30, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42 HSCHR6_MHC_SSTO:31529695-31536248
4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 16, 17, 18, 19, 21, 22, 23, 24, 26, 27, 28, 29, 30, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42 HSCHR6_MHC_MCF:31616059-31622614
3, 4, 5, 6, 7, 8, 9, 10, 11, 14, 16, 17, 18, 19, 21, 22, 23, 24, 26, 27, 28, 29, 30, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42 chr6:31539752-31546305

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC321958.txt GAATTCTCGAACTTCCTTTGTAGAAACTTTGGAAGGTGTCTGCCACATTGATCCTGGAATGTGTGTTTATTTGGGGTTATATAATCTGTTCTGTGGAAGCCACCTGAAGTCAGGAAGAGATGGAGGGCATCCTTCAGGAGTGAGATGAGACCTCATCATACTTGACTGTCCAGCATCATCTCTGAGTGAGGGGACCAAAAATTTATCTTCCAACTAGGACACTTTCAAGAGTGGAAGGGGGATCCATTAATATTTTCACCTGGACAAGAGGCAACACCAGAATGTCCCCGATGAAGGGGATATATAATGGACCTTCTTGATGTGAAACCTGCCAGATGGGCTGGAATCCGTATACTGGGACAAGTATGATTTGAGTTGGGGACAAGGACAGGGGTACAAGAGAAGGAAATGGGCAAAGAGAGAAGCCTGTACTCAGCCAAGGGTGCAGAGATGTTATATATGATTGCTCTTCAGGGAACCGGGCCTCCAGCTCACACCCCAGCTGCTCAACCACCTCCTCTCTGAATTGACTGTCCCTTCTTTGGACTCTAGGCCTGACCCCACTCCCTGGCCCTCCCAGCCCACGATTCCCCTGACCCGACTCCCCCCAGAACTCAGTCGCCTGAACCCCCAGCCTGTGGTTCTCTCCTAGGCCTCAGCC
1 PMC321958.txt GACTGAACAGCAGTATCTTCTAAGCCCTGGGGGCTTCCCCGGGCCCCAGCCCCGACCTAGAACCCGCCCGCTGCCTGCCACGCTGCCACTGCCGCTTCCTCTATAAGGGACCTGAGCGTCCGGGCCCAGGGGCTCCGCACAGCAGGTGAGGCTCTCCTGCCCCATCTCCTTGGGCTGCCCGTGCTTCGTGCTTTGGACTACCGCCCAGCAGTGTCCTGCCCTCTGCCTGGGCCTCGGTCCCTCCTGCACCTGCTGCCTGGATCCCCGGCCTGCCTGGGCCTGGGCCTTGGTGGGGGTTGGCCTTCTCTGTCTCTGACTCTCCATCTGTCAGTCTCATTGTCTCTGTCACACATTCTCTGCTGCCATGGTTCCTCTCTGTTCCCTTCCTGTCTCTCTCTGTCTCCCTCTGCTCACCTTGGGGTTTCTCTGACTGCATCTTGTCCCCTTCTCTGTCGATCTCTCTCTCGGGGGTCGGGGGGTGCTGTCTCCCAGGGCGG
2 PMC321958.txt AGGTCTGTCTTCCGCCGCGTGCCCCGCCCCGCTCACTGTCTCTCTCTCTCTCTCTCTTTCTCTGCAGGTTCTCCCCATGACACCACCTGAACGTCTCTTCCTCCCA
3 PMC321958.txt AGGGTGTGTGGCACCACCCTACACCTCCTCCTTCTGGGGCTGCTGCTGGTTCTGCTGCCTGGGGCCCAGGTGAGGCAGCAGGAGAATGGGGGCTGC
4 PMC321958.txt TGGGGTGGCTCAGCCAACCTTGAGCCCTAGAGCCCCCCTCAACTCTGTTCTCCCCTAGGGGCTCCCTGGTGTTGGCCTCACACCTTCAGCTGCCCAGACTGCC
5 PMC321958.txt CGTCAGCACCCCAAGATGCATCTTGCCCACAGCAACCTC
6 PMC321958.txt CCTGCTGCTCACCTCATTGGTAAACATCCACCTGACCTCCCAGACATGTCCCCACCAGCTCTCCTCCTACCCCTGCCTCAGGAACCCAAGCATCCACCCCTCTCCCCCAACTTCCCCCACGCTAAAACAGAGGGAGCCCACTCCTATGCCTCCCCCTGCCATCCCCCAGGAA
7 PMC321958.txt CTCAGTTGTTCAGTGCCCACTTCCTCAGGATTGAGACCTCTGATCCAGACCCCTGATCTCCCACCCCCATCCCCTATGGCTCTTCCTAGGAGACCCCAGCAAGCAGAAC
8 PMC321958.txt ACGGACCGTGCCTTCCTCCAGGATGGTTTCTCCTTGAGCAAC
9 PMC321958.txt TCTCTCCTGGTCCCCACCAGTGGC
10 PMC321958.txt ATCTACTTCGTCTACTCCCAGGTGGTCTTCTCTGGG
11 PMC321958.txt GCCTACTCTCCCAAGGCCACCTCCTCCCCACTCTACCTGGCCCATGAGGTC
12 PMC321958.txt CAGCTTCTTCCCCTCCCCGCCCCGTTCCATGTGCCTCTCCTCAGCTCCCAG
13 PMC321958.txt ATGGTGTATCCACGGCTGCAGGTCCCTGGCTGCAC
14 PMC321958.txt GCGTTCCATCTCACCCAGGGAGACCAGCTATCCACCCACACAGATGGCATCCCCCAGGTTAATCCTCAGCCCT
15 PMC321958.txt AGTACTGTCTTCTTTGGAGCCTTCGCTCTGTAGAACTTGGAAAATCCAGAAAGAAAAATAATTGACAAGACCTTCTCCCCATTCTGCCTCCATTCTGACCATTTCAGGGGTCGTCACCACTCCTGGCCCATTCCAACACCTCGTCTTCCCTGATCGGGTCACCGGAGCTTTCATGGAATTCTAGGCATCCCAGGGGACCACACCTCCTTGCCATCCCTGATGTCTGTCTCGCTGAGGATTTCGCCTGCCTAGGCATTCCCATCCCACTGTTGGTCTTGTCCACCAGCTAGGTGGGGCCTAGATCCACACACAGAGGAGAGCAGGCACATGGAGGAGCTTGGGGGATGACTAGAGGCAGGGAGGACTAATGAAGGCAAAAAATTAAATTAATTTATGGAGGATGGAGAGAGGGGATAATAGAAGAACATCCAAGGAGAACAGAGACAGGCCCAAGAGATGAAGAGTGAGAGGCATGCGCACAAGGCTGACCAAGAGAAAAGAAGTAGGCATGAGGGATCACAGGGCCCCAGAAGGCAGGGAAGGCTCTGAAGCCAGCTGCCGACCAGAGCCCACACGGAGGCATCTGCACCCTCGATCAGACCCCATCCACCTCTTTTCTCTCCATGGCTGCTTCTTGTTTTGTGTCTGGGAGTGAGAACTTCCCAGTCTATCTGTGGATGGAGGGAGGGACAGAGGACTCAGGGAGCCAGATCTCTGGGGAGCGTATCCCTCAGAGAGCTTCAGTGATATGTGATGGACTCACCAGGTGAGGCCGCCAGACTGCTGCAG
16 PMC321958.txt GTTCCGGGTGATTTCACTCCCGGCTGTCCAGGCTTGTCCTGCTACCCCACCCAGCCTTTCCTGAGGCCTCAAGCCTGCCACCAAGCCCCCAGCTCCTTCTCCCCGCAGGACCCAAACACAGGCCTCAGGACTCAACACAGCTTTTCCCTCCAACCCGTTTTCTCTCCCTCAACGGACTCAGCTTTCTGAAGCCCCTCCCAGTTCTAGTTCTATCTTTTTCCTGCATCCTGTCTGGAAG
17 PMC321958.txt CACAGACCTGGTCCCCAAAAGAATGGAGGCAATAGGTTTTGAGGGGCATGGGGACGGGGTTCAGCCTCCAGGGTCCTACACACAAATCAGTCAGTGGCCCAGAAGACCCCCCTCGGAATCGGAGCAGGGAGGATGGGGAGTGTGAGGGGTATCCTTGATGCTTGTGTGTCCCCAACTTTCCATCCCCGCCCCCGCGATGGAGAAGAAACCGAGACAGAAGGTGCAGGGCCCACTACCGCTTCCTCCAGATGAGCTCATGGGTTTCTCCACCAAGGAAGTTTTCCGCTGGTTGAATGATTCTTTCCCCGCCCTCCTCTCGCCCCAGGGACATAAGGCAGTTGTTGGCACACCCAGCCAGCAGACGCTCCCTCAGCAAGGACAGCAGAGGACCAGCTAAGAGGGAGAGAAGCACTACAGACCCCCCCTGAAACAACCCTCAGACGCCACATCCCCTGA
18 PMC321958.txt CAAGCTGCCAGGCAGGTTCTCTTCCTCTCACATACTGACCCACGGCTTCACCCTCTCTCCCCTGGAAAGGACACCATGAGCACTGAAAGCATGATCCGGGACGTGGAG
19 PMC321958.txt CTGGCCGAGGAGGCGCTCCCCAAGAAGACAGGGGGGCCCCAGGGCTCCAGGCGGTGCTTGTTCCTCAGCCTCTTCTCCTTCCTGATCGTG
20 PMC321958.txt GCAGGCGCCACCACGCTCTTCTGCCTGCTGCACTTTGGAGTGATCGGCCCCCAGAGGGAAGAGGTGAGTGCCTGGCCAGCCTTCATCCACTCTCCCACCCAAGGGGAATGAGAGACGCAAGAGAGGGAGAGAGATGGGATGGGTGAAGATGTGCGCTGATAGGGAGGGATGAGAGAGAAACATGGAGAAGACGGGGATGCAGAAAGAGATGTGGCAAGAGATGGGGAAGAGAGAGAGAGAAGATGGAGAGACAGGATGTCTGGCACATGGAAGGTGCTCACTAGTGTGTATGGAGTGAATGAATGAATGAATGAATGAACAAGCAGATATATAAATAAGATATGGAGACAGATGTGGGGTGTGAGAAGAGAGATGGGGGAAGAAACAAGTGATATGAATAAGATGGTGAGACAGAAAGAGCGGGAAATATGACAGCTAAGGAGAGAGATGGGGGAGATAAGGAGAGAAGAAGATAGGGTGTCTGGCACACAGAAGACACTCAGGGAAGAGCTGTTGAATGCTGGAGGTGAATACACAGATGAATGGAGAGAGAAACCAGACACCT
21 PMC321958.txt CAGGGCTAAGAGCGCAGGCCAGACAGGCAGCCAGCTGTTCCTCCTTTAAGGGTGACTCCCTCGATGTTACCATTCTCTTCTCCCCAACAGTTCCCCAGGGACCTCTCTCTA
22 PMC321958.txt ATCAGCCCTCTGGCCCAGGCAGTCAGTAAGTGTCTCCAAACCTCTTTCCTAATTCTGGGTTTGGGTTTGGGGGTAGGGTTAGTACCGGTATGGAAGCAGTGGGGGAATT
23 PMC321958.txt TAAAGTTTTGGTCTTGGGGGAGGATGGATGGAGGTGAAAGTAGGGGGGTATTTTCTAGGAAGTTTAAGGGTCTCAGCTTTTTCTTTTCTCTCTCCTCTTCAGGATCATCTTCT
24 PMC321958.txt CGAACCCCGAGTGACAAGCCTGTAGCCCATGTTGTAGGTAAGAGCTCTGAGGATGTGTCTTGGAACTTGGAGGGCTAGGATTTGGGGATTGAAGCCCGGCTGATGGTAGGCAGCTTGGAGACTGTGAGCGGACTCGCTGAGCTCCAGGGCAGGGTGGAGGCCAGCACAGGCCTTAGTGGGATACTCAGCGTCATCATGGATGGGGTGGGATGACA
25 PMC321958.txt GACAGAGAGGACAGGAACCGGATGTGGGGTGGGCAGAGCTCGAGGGCCAGGATGTGGAGAGTGAACCGACATGGCCACACTGACTCTCCTCTCCCTCTCTCCCTCCCTCCAGCAAAC
26 PMC321958.txt CGCCGGGCCAATGCCCTCCTGGCCAATGGCGTGGAGCTGAGAGATTTCCAGCTGGTG
27 PMC321958.txt GTGCCATCAGAGGGCCTGTACCTCCTACTCCCAGGTCCATC
28 PMC321958.txt GGCCAAGGCTGCCCCTCCACCCATGTGCTCCTCACCCACC
29 PMC321958.txt ATCAGCCGCATCGCCGTCTCCTACCAGACCAAGGTCAACCTCCTCTCTGCCATCAAGAGCCCCTGCCAGAGGGAGACCCCAGAGGGGGCT
30 PMC321958.txt GAGGCCAAGCCCTGGTATGAGCCCATCTATCTGGGAGGGGTCTTCCAGCTGGAGAAGGGTGACCGACTCAGCGCTGAGATCAATCGGCCC
31 PMC321958.txt GACTATCTCGACTTTGCCGAGTCTGGGCAGGTCTACTTTGGGATCATTGCCCTGTGAGGAGGACGAACATCCAACCTTCCCAAACGCCTCCCCTGCCCCAATCCCTTTATTACCCCCTCCTTCAGACACCCTCAACCTCTTCTGGCTCAAAGAGAATTGGGGGCTTAGGGTCGGACCCAAGCTTAGAACTTTAAGCAACAAGACCACCACTTCGAACCTGGGATTCAGGCATGTGTGGCCTGCACAGTGGTGCTCCTTTAACATACTGCTTCACTGGGGCCTCCAGTCTCACTGGGGCCTACAGCTTTGATCCCTGACATCTGGCTCTGGAGACCAGGGAGCCTTTGTTCTGGCCAACAGGTCAGGACTTGAGAAGACCTCACCTAGTTGACACTGTGGACCTTAGGCCTTCCTCATCTCACATGTCAGACTTCCTTGAGACACGGAGCCCAGCCCTCCCCATGGAGCCAGCTCCCTCTATTTATGTTTGCACTTGTGATTATTTATTATTTATTTATTATTTATTTATTTACAGATGATGTATTTATTTGGGAGACCGGGGTATCCTGGGGGACCCAATGTAGGAGCTGCCTTGGCTCAGACATGTTTTCCGTGAAACGGAGCTGAACATAGGCTGTTCCCATGTAGCCCCCTGGCCTCTGTGCCTTCTTTTGATTATGTTTTTCAC
32 PMC321958.txt CCTGTAACCATGCTGATTTGGTGACCCTACTGTCAATTGCTGAGCGCTGCCCCCAGAGATTGTGTCTGTTCGCCCTACTATTCAGTGGCGAGAATAAAGTTTGCTTAGAAAGAAACATGGTCTCCTTCTTGGAATTAATTCTGCATCTGCCTCTTCTTGTGGGTGGGAAGAAGCTCCCTAAGTCCTCTCTCCACAGGCTTTAAGATCCCTCGGACCCAGTCCCATCCTTAGACTCCTAGGGCCCTGGAGACCCTACATAAACAAAGCCCAACAGAATATTCCCCATCCCCCAGGAAACAAGAGCCTGAACCTAATTACCTCTCCCTCAGGGCATGGGAATTTCCCTCTCGGTTC
33 PMC321958.txt CCCAGCTCAGTCGCCTGAACCCCCACCTGTGGTT
34 PMC321958.txt CTTTGTGTCCCCCTTTCCAAATCCCCGCCCCCGCGAT
35 PMC321958.txt CTCTCCTAGGCCTCAGCCTCCTGCCTTGACTGAAACA
36 PMC321958.txt GGAGAAGAAACCGAGACAGAAGGTGCAGGGCCCACTACCG
37 PMC321958.txt GCAGTATCTTCTAAGCCCTGGGGGCTTCCCCGGGCCCCAG
38 PMC321958.txt CTTCCCAGATGAGCTCATGGGTTTCTCCACCAAGGAAG
39 PMC321958.txt CCCCGACCTAGAACCCGCCCGCTGCCTGCCACGCTG
40 PMC321958.txt TCCGCTGGTTGTGATTCTTTCCCCGCCCTCCTCTC
41 PMC321958.txt TGCCGCTTCCTCTATAAAGGGACCTGAGCGTCCGGGCCCA
42 PMC321958.txt GCCCCAGGGACATATAAAGGCAGTTGTTGGCACACCCA
Display recognized sequences in FASTA format