text2genome

About us

Related Links

Press Coverage

PubMed: 15813970    PubMedCentral: PMC1112612

Anti-inflammatory therapy by ibudilast, a phosphodiesterase inhibitor, in demyelination of twitcher, a genetic demyelination model.

Kagitani-Shimono K, Mohri I, Fujitani Y, Suzuki K, Ozono K, Urade Y, Taniike M
Journal of neuroinflammation, 10 , 2005

Abstract:

BACKGROUND: Twitcher mouse (twi/twi) is an authentic murine model of Krabbe's disease. Accumulation of psychosine, resulting in apoptosis of oligodendrocytes and subsequent demyelination, is a cardinal event to the pathogenesis of this disease. Moreover, recruitment of inflammatory cells plays a significant role in the pathological process in the twi/twi central and peripheral nervous systems. In this study, we investigated the 1) the relationship between tumor necrosis factor-alpha (TNFalpha), pro-inflammatory cytokine, and the progression of this disease and 2) effect of the anti-inflammatory therapy by ibudilast, a phosphodiesterase inhibitor. METHODS: We quantified the expression level of TNFalpha and TNF-receptor mRNA in twi/twi using semi-quantitative RT-PCR. The relationship between TNFalpha expression, apoptosis of oligodendrocytes and demyelination was studied with immunohistochemistry and TUNEL method. We then treated twi/twi with a daily intraperitoneal injection of ibudilast (10 mg/kg), which suppress TNFalpha production in the brain. RESULTS: We found that TNFalpha-immunoreactive microglia/macrophages appeared in the twi/twi brain and that the mRNA levels of TNFalpha and TNF-receptor 1 was increased with the progression of demyelination. The distribution profile of TNFalpha-immunoreactive microglia/macrophages overlapped that of TUNEL-positive oligodendrocytes in the twi/twi brain. When twi/twi was treated with ibudilast from PND30, the number of oligodendrocytes undergoing apoptosis was markedly reduced and demyelination was milder. Obvious improvement of clinical symptom was noted in two of five. The failure of constant clinical improvement by ibudilast may result from hepatotoxicity and/or the inhibition of proliferation of NG2-positive oligodendrocyte precursors. CONCLUSION: We conclude that anti-inflammatory therapy by a phosphodiesterase inhibitor can be considered as a novel alternative therapy for Krabbe's disease.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:13003/Vcan
EntrezGene:14420/Galc
EntrezGene:1464/CSPG4
EntrezGene:17196/Mbp
EntrezGene:1791/DNTT
EntrezGene:2668/GDNF
EntrezGene:2670/GFAP
EntrezGene:3815/KIT
EntrezGene:4153/MBL2
EntrezGene:4155/MBP
EntrezGene:4803/NGF
EntrezGene:4843/NOS2
EntrezGene:627/BDNF
EntrezGene:7132/TNFRSF1A
EntrezGene:7133/TNFRSF1B
EntrezGene:81651/CSPG4_RAT

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Tnf ENSMUSG00000024401 0,1,8,9
Tnfrsf1b ENSMUSG00000028599 2,3
Tnfrsf1a ENSMUSG00000030341 4,5
Gapdh ENSMUSG00000057666 6,7

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
6, 7 chr8:77929447-77929754
6, 7 chr2:151200445-151200752
6, 7 chr5:106291750-106292057
6, 7 chr7:59002730-59003037
0, 1, 8, 9 chr17:35337136-35337830
6, 7 chr2:149569574-149569866
6, 7 chr10:22511754-22512048
6, 7 chr4:57383855-57384162
6, 7 chr15:84697407-84697717
6, 7 chr13:94064368-94064675
6, 7 chr14:12113476-12113783
6, 7 chr1:15258910-15259217
6, 7 chr9:109732918-109733224
6, 7 chr14:49028964-49029271
6, 7 chr1:182257332-182257639
6, 7 chr3:52417420-52417727
6, 7 NT_166349:397085-397392
6, 7 chr14:103769712-103770019
6, 7 chr1:12556129-12556436
6, 7 chr10:33528333-33528637
6, 7 chr4:83751468-83751775
6, 7 chr15:4835783-4836090
6, 7 chr9:75541490-75541797
6, 7 chr6:125112080-125112581
6, 7 chrX:77439220-77439527
6, 7 chr8:42694052-42694359
6, 7 chr7:96756868-96757175
6, 7 chr8:95239856-95240163
4, 5 chr6:125312008-125312224
6, 7 chr7:49380600-49380907
6, 7 chr6:91379540-91379847
6, 7 chr4:82840560-82840867
6, 7 chr2:11330687-11330994
6, 7 chr3:142626238-142626545
6, 7 chr1:102178936-102179242
6, 7 chr15:12505307-12505614
6, 7 chr5:28865773-28866080
6, 7 chr11:20235045-20235352
2, 3 chr4:144814287-144815361
6, 7 chr6:128152195-128152586
6, 7 chr4:91518389-91518696
6, 7 chr1:13775994-13776301
6, 7 chr6:22654078-22654385
6, 7 chr2:146580464-146580771
6, 7 chr8:60029762-60030069

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC1112612.pdf AGTGACAAGCCTGTAGCCCACG
1 PMC1112612.pdf TTTCTCCTGGTATGAGATAGC
2 PMC1112612.pdf CTAAACAGCAGAACCGAGTGT
3 PMC1112612.pdf AGATACGTAGAGTGTCCTTGG
4 PMC1112612.pdf ATAAAGCCACACCCACAACCT
5 PMC1112612.pdf CATCTCCCTGCCACTCACAAG
6 PMC1112612.pdf TGAACGGGAAGCTCACTGG
7 PMC1112612.pdf TCCACCACCCTGTTGCTGTA
8 PMC1112612.pdf GATGGGTTGTACCTTGTCTACTCC
9 PMC1112612.pdf CTAAGTACTTGGGCAGATTGACCT
Display recognized sequences in FASTA format