text2genome

About us

Related Links

Press Coverage

PubMed: 10339451    PubMedCentral: PMC1566583

Combined effect of cigarette smoke and mineral fibers on the gene expression of cytokine mRNA.

Morimoto Y, Tsuda T, Hori H, Yamato H, Ohgami A, Higashi T, Nagata N, Kido M, Tanaka I
Environmental health perspectives, 495 , 1999

Abstract:

To investigate which parameters are stimulated by mineral fibers and whether cigarette smoke enhanced a fiber-induced response, we examined the level of cytokine mRNA from alveolar macrophages (AMs) and lungs of rats exposed to mineral fibers and cigarette smoke in vivo. Male Wistar rats were given a single intratracheal instillation of 2 mg of Union Internationale Contre le Cancer chrysotile or refractory ceramic fiber (RF1). The animals then inhaled a side stream of smoke 5 days per week for 4 weeks. The expression of manganese superoxide dismutase, inducible nitric oxide synthase (iNOS), basic fibroblast growth factor (bFGF), interleukin-1[alpha] (IL-1[alpha]), interleukin-6 (IL-6), and tumor necrosis factor-[alpha] (TNF[alpha]) mRNA from lipopolysaccharide-stimulated AMs and lungs of rats exposed to mineral fibers and/or cigarette smoke were assessed using semiquantitative reverse-transcriptase polymerase chain reaction. Exposure only to cigarette smoke increased in IL-1[alpha] mRNA levels in AMs. Chrysotile stimulated the expression of IL-1[alpha], TNF[alpha], and IL-6 in AMs, and the expression of bFGF in lungs. RF1 resulted in increased expression of IL-1[alpha] and TNF[alpha] in AMs. Cigarette smoke stimulated the gene expression of iNOS in AMs and IL-6 and bFGF in lungs treated with chrysotile; IL-1[alpha] in AMs and bFGF in lungs did the same in lungs with RF1. Among these cytokines, message levels of IL-1[alpha], iNOS, and bFGF were increased in rats stimulated with mineral fibers, and the stimulating effects of mineral fibers were enhanced by cigarette smoke. Therefore, IL-1[alpha], iNOS, and bFGF would be the possible parameters of the lung remodeling induced by mineral fibers.

Organism/Genes in external databases

Datasource Data

Best predicted genome from sequences: Rattus norvegicus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TNFA_RAT ENSRNOG00000000837 0,1
IL1A_RAT ENSRNOG00000004575 2,3
IL6_RAT ENSRNOG00000010278 4,5
NOS2_RAT ENSRNOG00000011023 6,7
SODM_RAT ENSRNOG00000019048 8,9
FGF2_RAT ENSRNOG00000017392 11,10
ACTB_RAT ENSRNOG00000034254 12,13

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
5 chr4:457149-457174
1 chr20:3662494-3662518
6, 7 chr10:65062610-65120784
2, 3 chr3:116914223-116914847
10, 11 chr2:123936357-123947117
8, 9 chr1:41864430-41869966
12, 13 chr12:12049003-12049359

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC1566583.txt TACTGAACTTCGGGGTGATTGGTCC
1 PMC1566583.txt CAGCCTTGTCCCTTGAAGAGAACC
2 PMC1566583.txt CTAAGAACTACTTCACATCCGCAGC
3 PMC1566583.txt CTGGAATAAAACCCACTGAGGTAGG
4 PMC1566583.txt CAAGAGACTTCCAGCCAGTTGC
5 PMC1566583.txt TTGCCGAGTAGACCTCATAGTGACC
6 PMC1566583.txt CAAGAACGTGTTCACCATGA
7 PMC1566583.txt AAAGCAGGGCACTGGGTCTT
8 PMC1566583.txt GCGACCTACGTGAACAATCTGAACG
9 PMC1566583.txt TCAATCCCCAGCAGTGGAATAAGGC
10 PMC1566583.txt CAAGCAGAAGAGAGAGGAGTT
11 PMC1566583.txt TCAGCTCTTAGCAGACATTG
12 PMC1566583.txt ATCATGTTTGAGACCTTCAACACC
13 PMC1566583.txt TAGCTCTTCTCCAGGGAGG
Display recognized sequences in FASTA format