text2genome

About us

Related Links

Press Coverage

PubMed: 14734816    PubMedCentral: PMC373372

Highly sensitive amperometric detection of genomic DNA in animal tissues.

Xie H, Yu YH, Mao PL, Gao Z
Nucleic acids research, e15 , 2004

Abstract:

A simple and highly sensitive method for the detection of genomic DNA in tissue samples is described. It is based on amperometric detection of target DNA by forming an analyte/polymeric activator bilayer on a gold electrode. The biotinylated target DNA is hybridized to oligonucleotide capture probes immobilized on the gold electrode, forming the first layer. A subsequent binding of glucose oxidase-avidin conjugate to the target DNA and the introduction of a second layer of a redox polymer to the electrode, via layer-by-layer electrostatic self-assembly, allow for electrochemical detection of the catalytic oxidation current of glucose in a PBS solution. Less than 2.0 fg of rat genomic DNA, for both regulated and house-keeping genes, can be easily detected in 2.5 microl droplets. The proposed procedure shows very high specificity for genomic DNA in a RT-PCR mixture.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:24383/G3P_RAT
EntrezGene:24842/P53_RAT
EntrezGene:2597/GAPDH
EntrezGene:54363/HAO1
EntrezGene:7157/TP53

Best predicted genome from sequences: Rattus norvegicus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
G3P_RAT ENSRNOG00000018630 1,5,6
P53_RAT ENSRNOG00000010756 2,4

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
1, 5, 6 chr6:64191386-64192377
1, 5, 6 chr6:80063305-80064322
1, 5, 6 chr7:121242311-121243311
2, 4 chr10:56406566-56410701
1, 5, 6 chr5:117080274-117081276

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC373372.pdf ATGGTGAAGGTCGGTGTCAA
1 PMC373372.pdf TTACTCCTTGGAGGCCATGT
2 PMC373372.pdf ATGGAGGATTCACAGTCGGA
3 PMC373372.pdf ATGGAGGATTCACAGTCGGA
4 PMC373372.pdf TCAGTCTGAGTCAGGCCCCA
5 PMC373372.pdf TTACTCCTTGGAGGCCATGTAGG
6 PMC373372.pdf ATGGTGAAGGTCGGTGTCAACGG
7 PMC373372.pdf CCTCTCGCGAGTCAACAGAAACG
Display recognized sequences in FASTA format