text2genome

About us

Related Links

Press Coverage

PubMed: 18986529    PubMedCentral: PMC2613381

Dietary fish oil did not prevent sleep deprived rats from a reduction in adipose tissue adiponectin gene expression.

de Mattos AB, Pinto MJ, Oliveira C, Biz C, Ribeiro EB, do Nascimento CM, Andersen ML, Tufik S, Oyama LM
Lipids in health and disease, 43 , 2008

Abstract:

Sleep deprivation in humans has been related to weight gain and consequently, increased risk for insulin resistance. In contrast, there is a significant loss of weight in sleep deprived rats suggesting a state of insulin resistance without obesity interference. Thus, we aimed to assess the effects of a rich fish oil dietetic intervention on glucose tolerance, serum insulin and adiponectin, and adipose tissue gene expression of adiponectin and TNF-alpha of paradoxically sleep deprived (PSD) rats. The study was performed in thirty day-old male Wistar randomly assigned into two groups: rats fed with control diet (soybean oil as source of fat) and rats fed with a fish oil rich diet. After 45 days of treatment, the animals were submitted to PSD or maintained as home cage control group for 96 h. Body weight and food intake were carefully monitored in all groups. At the end of PSD period, a glucose tolerance test was performed and the total blood and adipose tissues were collected. Serum insulin and adiponectin were analyzed. Adipose tissues were used for RT-PCR to estimate the gene expression of adiponectin and TNF-alpha. Results showed that although fish oil diet did not exert any effect upon these measurements, PSD induced a reduction in adiponectin gene expression of retroperitoneal adipose tissues, with no change in serum adiponectin concentration or in adiponectin and TNF-alpha gene expression of epididymal adipose tissue. Thus, the stress induced by sleep deprivation lead to a desbalance of adiponectin gene expression.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:1506/CTRL
EntrezGene:171381/PSD1_RAT
EntrezGene:24835/TNFA_RAT
EntrezGene:3251/HPRT1
EntrezGene:4858/NOVA2
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:9370/ADIPOQ

Best predicted genome from sequences: Rattus norvegicus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TNFA_RAT ENSRNOG00000000837 2,3
HPRT_RAT ENSRNOG00000031367 4,5

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
5 chrX:139942018-139942042
2, 3 chr20:3661279-3662692

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2613381.pdf GAAGTAGACTCTGCTGAGATGG
1 PMC2613381.pdf TATCAGTGTAGGAGGTCTGTGATG
2 PMC2613381.pdf CGCTCTTCTGTCTACTGAAC
3 PMC2613381.pdf TTCTCCAGCTGGAAGACTCC
4 PMC2613381.pdf CTCATGGACTGATTATGGACAGGA
5 PMC2613381.pdf GCAGGTCAGCAAAGAACTTATAGC
Display recognized sequences in FASTA format