text2genome

About us

Related Links

Press Coverage

PubMed: 19002260    PubMedCentral: PMC2577894

p53 plays a role in mesenchymal differentiation programs, in a cell fate dependent manner.

Molchadsky A, Shats I, Goldfinger N, Pevsner-Fischer M, Olson M, Rinon A, Tzahor E, Lozano G, Zipori D, Sarig R, Rotter V
PloS one, , 2008

Abstract:

BACKGROUND: The tumor suppressor p53 is an important regulator that controls various cellular networks, including cell differentiation. Interestingly, some studies suggest that p53 facilitates cell differentiation, whereas others claim that it suppresses differentiation. Therefore, it is critical to evaluate whether this inconsistency represents an authentic differential p53 activity manifested in the various differentiation programs. METHODOLOGY/PRINCIPAL FINDINGS: To clarify this important issue, we conducted a comparative study of several mesenchymal differentiation programs. The effects of p53 knockdown or enhanced activity were analyzed in mouse and human mesenchymal cells, representing various stages of several differentiation programs. We found that p53 down-regulated the expression of master differentiation-inducing transcription factors, thereby inhibiting osteogenic, adipogenic and smooth muscle differentiation of multiple mesenchymal cell types. In contrast, p53 is essential for skeletal muscle differentiation and osteogenic re-programming of skeletal muscle committed cells. CONCLUSIONS: These comparative studies suggest that, depending on the specific cell type and the specific differentiation program, p53 may exert a positive or a negative effect, and thus can be referred as a "guardian of differentiation" at large.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:1026/CDKN1A
EntrezGene:12097/Bglap2
EntrezGene:121340/SP7
EntrezGene:12393/Runx2
EntrezGene:1264/CNN1
EntrezGene:12797/Cnn1
EntrezGene:14463/Gata4
EntrezGene:14465/Gata6
EntrezGene:15452/Hprt1
EntrezGene:170574/Sp7
EntrezGene:17246/Mdm2
EntrezGene:17877/Myf5
EntrezGene:17927/Myod1
EntrezGene:17928/Myog
EntrezGene:18091/Nkx2-5
EntrezGene:18505/Pax3
EntrezGene:18509/Pax7
EntrezGene:214384/Myocd
EntrezGene:2167/FABP4
EntrezGene:22059/Trp53
EntrezGene:22061/Trp63
EntrezGene:2597/GAPDH
EntrezGene:30590/tp53
EntrezGene:3251/HPRT1
EntrezGene:4617/MYF5
EntrezGene:5077/PAX3
EntrezGene:5081/PAX7
EntrezGene:58801/Pmaip1
EntrezGene:5925/RB1
EntrezGene:632/BGLAP
EntrezGene:6387/CXCL12
EntrezGene:652/BMP4
EntrezGene:6696/SPP1
EntrezGene:7157/TP53
EntrezGene:7161/TP73
EntrezGene:860/RUNX2
EntrezGene:8626/TP63
EntrezGene:93649/MYOCD
EntrezGene:9370/ADIPOQ
EntrezGene:9709/HERPUD1

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Fabp4 ENSMUSG00000062515 0,48
Adipoq ENSMUSG00000022878 1,2
Myf5 ENSMUSG00000000435 5,6
Myod1 ENSMUSG00000009471 7,8
Myog ENSMUSG00000026459 9,10
Nkx2-5 ENSMUSG00000015579 11,12
Gata4 ENSMUSG00000021944 15,16
Gata6 ENSMUSG00000005836 17,18
Myocd ENSMUSG00000020542 19,20
Cnn1 ENSMUSG00000001349 21,22
Acta2 ENSMUSG00000035783 23,24
Trp53 ENSMUSG00000059552 25,26
Hprt1 ENSMUSG00000025630 36,37
Sp7 ENSMUSG00000060284 38,39
Runx2 ENSMUSG00000039153 40,41
Pparg ENSMUSG00000000440 44,45
Cebpa ENSMUSG00000034957 46,47

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
12 chr17:26976551-26976571
47 chr7:35905283-35905303
13 chr13:117091842-117091861
3 chr1:78128965-78128986
21 chr10:120067685-120067779
10 chr1:136188271-136188292
7, 8 chr7:53633825-53633876
4 chr4:139296798-139296819
24 chr19:34326304-34326326
17, 18 chr18:11052714-11054057
1, 2 chr16:23146694-23155320
22 chr9:21910137-21910161
16 chr14:63823553-63823576
26 chr11:69401904-69401924
26 chr17:54559395-54559415
5 chr10:106921719-106921743
44 chr6:115391637-115391660
19, 20 chr11:65046620-65046684
38, 39 chr15:102189700-102189761
42, 43 chr3:88172663-88187593
36, 37 chrX:50369573-50373300
0, 48 chr3:10205240-10205292
41 chr17:44795591-44795618

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2577894.pdf CACCACCAGCTTGTCACCAT
1 PMC2577894.pdf GGATCTGACGACACCAAAAGG
2 PMC2577894.pdf AGGAGAGCTTGCAACAGTAGCAT
3 PMC2577894.pdf TCAGAGTCAATATCGGAGCCT
4 PMC2577894.pdf AGCTGCTGTTGATTACCTGGC
5 PMC2577894.pdf ACAGCAGCTTTGACAGCATCTACT
6 PMC2577894.pdf GCAGCACATGCATTTGATACATC
7 PMC2577894.pdf GTTCTTCACGCCCAAAAGATG
8 PMC2577894.pdf GGACAGTTGGGAAGAGTGTCATT
9 PMC2577894.pdf GTCCCAACCCAGGAGATCATT
10 PMC2577894.pdf GCAGATTGTGGGCGTCTGTAG
11 PMC2577894.pdf CCTCGGGCGGATAAAAAAGA
12 PMC2577894.pdf GGCTTTGTCCAGCTCCACTG
13 PMC2577894.pdf CGCCTTGCAAAGCGACATA
14 PMC2577894.pdf AAATTGACCAGTTGCTGAAAAGC
15 PMC2577894.pdf CACCCCAATCTCGATATGTTTGAT
16 PMC2577894.pdf TGACACACTCTCTGCCTTCTGAG
17 PMC2577894.pdf GGCCGTTCTTCTCGCACAT
18 PMC2577894.pdf CTACTCCAACCTGACTTTTGATTCC
19 PMC2577894.pdf TTACAGTTACGGCTTCAACAGAGAA
20 PMC2577894.pdf GCGGTATTAAGCCTTGGTTAGC
21 PMC2577894.pdf ATGGCCAAGACAAAAGGAAACA
22 PMC2577894.pdf CTCTGCATACTTGACTCCCACATT
23 PMC2577894.pdf ACATCAGGGAGTAATGGTTGGAAT
24 PMC2577894.pdf TCCCCCACATAGCTGTCTTTTT
25 PMC2577894.pdf CACGTACTCTCCTCCCCTCAAT
26 PMC2577894.pdf AACTGCACAGGGCACGTCTT
27 PMC2577894.pdf AGCCTCAAGATCATCAGCAATG
28 PMC2577894.pdf CACGATACCAAAGTTGTCATGGAT
29 PMC2577894.pdf CGAGTCTGATCCGGAGAAAGC
30 PMC2577894.pdf CTGTGAAAGAGGCCATAAAAGGTAA
31 PMC2577894.pdf CCGTGAAGAAGATCAATGAGTCAA
32 PMC2577894.pdf CAGGTCGTTGGCCTCAAAA
33 PMC2577894.pdf CGTAGCTGTCTTTTTGTCCCATT
34 PMC2577894.pdf GGATTGTGCAGACACTGAGTTTTTA
35 PMC2577894.pdf GACCGGTTACCGTGGATATGTT
36 PMC2577894.pdf GCAGTACAGCCCCAAAATGG
37 PMC2577894.pdf GGTCCTTTTCACCAGCAAGCT
38 PMC2577894.pdf CCTCTGCGGGACTCAACAAC
39 PMC2577894.pdf AAAGGTCAGCGTATGGCTTCTT
40 PMC2577894.pdf AGGCACAGACAGAAGCTTGATG
41 PMC2577894.pdf GCGATCAGAGAACAAACTAGGTTTAGA
42 PMC2577894.pdf GACCGCCTACAAACGCATCT
43 PMC2577894.pdf GGGCAGCACAGGTCCTAAATAGT
44 PMC2577894.pdf TCAGGCTTCCACTATGGAGTTCA
45 PMC2577894.pdf GAAAAAACCCTTGCATCCTTCA
46 PMC2577894.pdf CGGGCAAAGCCAAGAAGTC
47 PMC2577894.pdf CGTACCCGGTACTCGTTGCT
48 PMC2577894.pdf TGGAAAGTCGACCACAATAAA
Display recognized sequences in FASTA format