text2genome

About us

Related Links

Press Coverage

PubMed: 18691420    PubMedCentral: PMC2575591

High-molecular-weight hyaluronan--a possible new treatment for sepsis-induced lung injury: a preclinical study in mechanically ventilated rats.

Liu YY, Lee CH, Dedaj R, Zhao H, Mrabat H, Sheidlin A, Syrkina O, Huang PM, Garg HG, Hales CA, Quinn DA
Critical care (London, England), R102 , 2008

Abstract:

INTRODUCTION: Mechanical ventilation with even moderate-sized tidal volumes synergistically increases lung injury in sepsis and has been associated with proinflammatory low-molecular-weight hyaluronan production. High-molecular-weight hyaluronan (HMW HA), in contrast, has been found to be anti-inflammatory. We hypothesized that HMW HA would inhibit lung injury associated with sepsis and mechanical ventilation. METHODS: Sprague-Dawley rats were randomly divided into four groups: nonventilated control rats; mechanical ventilation plus lipopolysaccharide (LPS) infusion as a model of sepsis; mechanical ventilation plus LPS with HMW HA (1,600 kDa) pretreatment; and mechanical ventilation plus LPS with low-molecular-weight hyaluronan (35 kDa) pretreatment. Rats were mechanically ventilated with low (7 ml/kg) tidal volumes. LPS (1 or 3 mg/kg) or normal saline was infused 1 hour prior to mechanical ventilation. Animals received HMW HA or low-molecular-weight hyaluronan via the intraperitoneal route 18 hours prior to the study or received HMW HA (0.025%, 0.05% or 0.1%) intravenously 1 hour after injection of LPS. After 4 hours of ventilation, animals were sacrificed and the lung neutrophil and monocyte infiltration, the cytokine production, and the lung pathology score were measured. RESULTS: LPS induced lung neutrophil infiltration, macrophage inflammatory protein-2 and TNFalpha mRNA and protein, which were decreased in the presence of both 1,600 kDa and 35 kDa hyaluronan pretreatment. Only 1,600 kDa hyaluronan completely blocked both monocyte and neutrophil infiltration and decreased the lung injury. When infused intravenously 1 hour after LPS, 1,600 kDa hyaluronan inhibited lung neutrophil infiltration, macrophage inflammatory protein-2 mRNA expression and lung injury in a dose-dependent manner. The beneficial effects of hyaluronan were partially dependent on the positive charge of the compound. CONCLUSIONS: HMW HA may prove to be an effective treatment strategy for sepsis-induced lung injury with mechanical ventilation.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:1056/CEL
EntrezGene:114105/CXCL2_RAT
EntrezGene:12/SERPINA3
EntrezGene:2597/GAPDH
EntrezGene:31/ACACA
EntrezGene:3576/IL8
EntrezGene:3815/KIT
EntrezGene:5599/MAPK8
EntrezGene:7099/TLR4
EntrezGene:960/CD44

Best predicted genome from sequences: Rattus norvegicus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TNFA_RAT ENSRNOG00000000837 2,3
G3P_RAT ENSRNOG00000018630 4,5

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
4, 5 chr18:64975459-64975975
4, 5 chr8:75479687-75480202
4, 5 chr4:165675352-165675868
4, 5 chr3:128260273-128260789
4, 5 chr13:61675864-61676380
4, 5 chr7:121242359-121242875
2, 3 chr20:3661157-3662783
4, 5 chr8:105552605-105553120
4, 5 chr15:84510689-84511205
4, 5 chr13:12023762-12024276
4, 5 chr11:73603534-73604049
4 chr5:130543339-130544020
4, 5 chr11:70679930-70680446
4, 5 chr14:1949457-1949959
4, 5 chr2:191157770-191158271
4, 5 chr5:117080712-117081228
4, 5 chr4:161282461-161283288
4, 5 chr12:13672180-13672696
4, 5 chr5:73006291-73006807
4, 5 chr2:219334694-219335210
4, 5 chr12:13535673-13536174
0 chr14:18679062-18679083
4, 5 chr2:215916856-215917373
4, 5 chr8:44322160-44322676
4, 5 chr16:25751631-25752147
4, 5 chr2:182359314-182359945
4, 5 chr9:55396416-55396931
4, 5 chr7:34078268-34078771

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2575591.pdf TCCTCAATGCTGTACTGGTCC
1 PMC2575591.pdf ATGTTCTTCCTTTCCAGGTC
2 PMC2575591.pdf CATGATCCGAGATGTGGAACT
3 PMC2575591.pdf TCACAGAGCAATGACTCCAAAG
4 PMC2575591.pdf AATGCATCCTGCACCACCAA
5 PMC2575591.pdf GTAGCCATATTCATTGTCATA
Display recognized sequences in FASTA format