text2genome

About us

Related Links

Press Coverage

PubMed: 18093301    PubMedCentral: PMC2263055

The first trimester human trophoblast cell line ACH-3P: a novel tool to study autocrine/paracrine regulatory loops of human trophoblast subpopulations--TNF-alpha stimulates MMP15 expression.

Hiden U, Wadsack C, Prutsch N, Gauster M, Weiss U, Frank HG, Schmitz U, Fast-Hirsch C, Hengstschläger M, Pötgens A, Rüben A, Knöfler M, Haslinger P, Huppertz B, Bilban M, Kaufmann P, Desoye G
BMC developmental biology, 137 , 2007

Abstract:

BACKGROUND: The trophoblast compartment of the placenta comprises various subpopulations with distinct functions. They interact among each other by secreted signals thus forming autocrine or paracrine regulatory loops. We established a first trimester trophoblast cell line (ACH-3P) by fusion of primary human first trimester trophoblasts (week 12 of gestation) with a human choriocarcinoma cell line (AC1-1). RESULTS: Expression of trophoblast markers (cytokeratin-7, integrins, matrix metalloproteinases), invasion abilities and transcriptome of ACH-3P closely resembled primary trophoblasts. Morphology, cytogenetics and doubling time was similar to the parental AC1-1 cells. The different subpopulations of trophoblasts e.g., villous and extravillous trophoblasts also exist in ACH-3P cells and can be immuno-separated by HLA-G surface expression. HLA-G positive ACH-3P display pseudopodia and a stronger expression of extravillous trophoblast markers. Higher expression of insulin-like growth factor II receptor and human chorionic gonadotropin represents the basis for the known autocrine stimulation of extravillous trophoblasts. CONCLUSION: We conclude that ACH-3P represent a tool to investigate interaction of syngeneic trophoblast subpopulations. These cells are particularly suited for studies into autocrine and paracrine regulation of various aspects of trophoblast function. As an example a novel effect of TNF-alpha on matrix metalloproteinase 15 in HLA-G positive ACH-3P and explants was found.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:14268/Fn1
EntrezGene:1906/EDN1
EntrezGene:1909/EDNRA
EntrezGene:1950/EGF
EntrezGene:2039/EPB49
EntrezGene:2161/F12
EntrezGene:2335/FN1
EntrezGene:3082/HGF
EntrezGene:3135/HLA-G
EntrezGene:3135/HLA-G
EntrezGene:3135/HLA-G
EntrezGene:3135/HLA-G
EntrezGene:3135/HLA-G
EntrezGene:3135/HLA-G
EntrezGene:3135/HLA-G
EntrezGene:3479/IGF1
EntrezGene:3480/IGF1R
EntrezGene:3481/IGF2
EntrezGene:3482/IGF2R
EntrezGene:3655/ITGA6
EntrezGene:3672/ITGA1
EntrezGene:3815/KIT
EntrezGene:3855/KRT7
EntrezGene:4313/MMP2
EntrezGene:4324/MMP15
EntrezGene:5788/PTPRC
EntrezGene:6156/RPL30
EntrezGene:7076/TIMP1
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7133/TNFRSF1B
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:7431/VIM
EntrezGene:7462/LAT2

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
RPL30 ENSG00000156482 0,1
HLA-G ENSG00000204632 2,3
ITGA1 ENSG00000213949 4,5
ITGA5 ENSG00000161638 6,7
ITGA6 ENSG00000091409 8,9
MMP2 ENSG00000087245 10,11
MMP9 ENSG00000100985 12,13
MMP14 ENSG00000157227 14,15
MMP15 ENSG00000102996 16,17
EDNRA ENSG00000151617 20,21
EDNRB ENSG00000136160 22,23
CGB ENSG00000104827 24,25
CGB5 ENSG00000189052 24,25
CGB8 ENSG00000213030 24,25
IGF1 ENSG00000017427 26,27
IGF2 ENSG00000167244 28,29
IGF1R ENSG00000140443 30,31
IGF2R ENSG00000197081 32,33
INSR ENSG00000171105 34,35
TNF ENSG00000204490 36,37
TNF ENSG00000206439 36,37
TNF ENSG00000223952 36,37
TNF ENSG00000228321 36,37
TNF ENSG00000228849 36,37
TNF ENSG00000230108 36,37
TNF ENSG00000232810 36,37
TNFRSF1A ENSG00000067182 38,39
BIRC3 ENSG00000023445 40,41

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
30 chr15:99251178-99251198
16, 17 chr16:58073919-58074553
36, 37 HSCHR6_MHC_COX:31531978-31532545
4 chr5:52157342-52157362
2, 3 HSCHR6_MHC_QBL:29793194-29793720
28, 29 chr11:2154432-2156724
2, 3 HSCHR6_MHC_DBB:29793230-29793756
0, 1 chr8:99054039-99057609
36, 37 chr6:31544566-31545133
11 chr16:55517963-55517983
36, 37 HSCHR6_MHC_SSTO:31534509-31535076
18, 19 chr6:12292673-12294318
22, 23 chr13:78475313-78477340
6, 7 chr12:54802700-54803372
2, 3 chr6:29796006-29796532
12, 13 chr20:44638609-44639264
24, 25 chr19:49519822-49558136
27 chr12:102796306-102796326
26 chr12:102869445-102869465
2, 3 HSCHR6_MHC_MANN:29792938-29793464
34, 35 chr19:7143018-7152795
36, 37 HSCHR6_MHC_APD:31555887-31556454
41 chr11:102201786-102201806
36, 37 HSCHR6_MHC_QBL:31534809-31535376
31 chr15:99434588-99434608
36, 37 HSCHR6_MHC_DBB:31526710-31527277
14, 15 chr14:23316292-23316546
2, 3 HSCHR6_MHC_SSTO:29792700-29793226
32, 33 chr6:160453641-160455476
2, 3 HSCHR6_MHC_COX:29789693-29790219
2, 3 HSCHR6_MHC_MCF:29792888-29793414
20, 21 chr4:148441092-148453699
39 chr12:6442564-6442584
36, 37 HSCHR6_MHC_MANN:31584053-31584620
8, 9 chr2:173333919-173335794
36, 37 HSCHR6_MHC_MCF:31620875-31621442

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2263055.pdf CCTAAGGCAGGAAGATGGTG
1 PMC2263055.pdf CAGTCTGTTCTGGCATGCTT
2 PMC2263055.pdf AGGAGACACGGAACACCAAG
3 PMC2263055.pdf CCTCCAGGTAGGCTCTCCTT
4 PMC2263055.pdf GTCCAGTTGGGAGAGGTGAA
5 PMC2263055.pdf TGAATGCCTCCTTTCTTGCT
6 PMC2263055.pdf TCCTGGAGTCCTCACTGTCC
7 PMC2263055.pdf TCCTTGGCAGTAACCCTGTC
8 PMC2263055.pdf GGCGGTGTTATGTCCTGAGT
9 PMC2263055.pdf CATGCTCAGTCTCTCCACCA
10 PMC2263055.pdf TTGGCAGTGCAATACCTGAA
11 PMC2263055.pdf GAGCAAAGGCATCATCCACT
12 PMC2263055.pdf GAGACCGGTGAGCTGGATAG
13 PMC2263055.pdf CACCAAACTGGATGACGATG
14 PMC2263055.pdf AAGGCACACTTGCTCCTGTT
15 PMC2263055.pdf CACTGGTGAGACAGGCTTGA
16 PMC2263055.pdf GGCCGACATCATGGTACTCT
17 PMC2263055.pdf GTCAACGTCCTTCCACTGGT
18 PMC2263055.pdf CTCGTCCCTGATGGATAAA
19 PMC2263055.pdf TCCTGCTTGGCAAAAATTC
20 PMC2263055.pdf ATCACCGTCCTCAACCTCTG
21 PMC2263055.pdf CCAATTCCCTGAACACGACT
22 PMC2263055.pdf ATCTGCGAATCTGCTTGCTT
23 PMC2263055.pdf AGCCACCAATCTTTTGCTGT
24 PMC2263055.pdf GTCAACACCACCATCTGTGC
25 PMC2263055.pdf GGCCTTTGAGGAAGAGGAGT
26 PMC2263055.pdf TGGATGCTCTTCAGTTCGTG
27 PMC2263055.pdf CCTGCACTCCCTCTACTTGC
28 PMC2263055.pdf GGTGCTTCTCACCTTCTTGG
29 PMC2263055.pdf GGGGTATCTGGGGAAGTTGT
30 PMC2263055.pdf GGATGCGGTGTCCAATAACT
31 PMC2263055.pdf TGGCAGCACTCATTGTTCTC
32 PMC2263055.pdf TGAGTATGCCTGCCACAGAG
33 PMC2263055.pdf TCAAGGTGAGGTCTCCATCC
34 PMC2263055.pdf GAGTCCTCGTTTAGGAAGACG
35 PMC2263055.pdf AAGTGTTGGGGAAAGCTGCCA
36 PMC2263055.pdf GACAAGCCTGTAGCCCATGT
37 PMC2263055.pdf TTGATGGCAGAGAGGAGGTT
38 PMC2263055.pdf ACCAAGTGCCACAAAGGAAC
39 PMC2263055.pdf CTGCAATTGAAGCACTGGAA
40 PMC2263055.pdf CCAAGTGGTTTCCAAGGTGT
41 PMC2263055.pdf CACGGCAGCATTAATCACAG
Display recognized sequences in FASTA format