text2genome

About us

Related Links

Press Coverage

PubMed: 18725994    PubMedCentral: PMC2518221

Inhibition of angiogenic factor production from murine mast cells by an antiallergic agent (epinastine hydrochloride) in vitro.

Asano K, Furuta A, Kanai K, Sakaue S, Suzaki H, Hisamitsu T
Mediators of inflammation, , 2008

Abstract:

Angiogenesis is an important event both in the development of allergic inflammatory responses and in the pathophysiology of tissue remodeling in allergic diseases. In the present study, therefore, we examined the influence of antihistamines on angiogenesis through the choice of epinastine hydrochloride (EP) and murine mast cells in vitro. Mast cells (5 x 10(5) cells/mL) presensitized with murine IgE specific for ovalbumin (OVA) were stimulated with 10 ng/mL OVA in the presence of various concentrations of EP for 4 hours. The levels of angiogenesis factors, keratinocyte-derived chemokine (KC), tumor necrosis factor-alpha (TNF), and vascular endothelial growth factor (VEGF) in culture supernatants, were examined by ELISA. We also examined mRNA expression for the angiogenesis factors by RT-PCR. EP significantly inhibited the production of KC, TNF, and VEGF induced by IgE-dependent mechanism at more than 25 ng/mL. Semiquantitative analysis using RT-PCR showed that EP also significantly reduced mRNA expressions for KC, TNF, and VEGF. These results strongly suggest that EP suppresses angiogenesis factor production through the inhibition of mRNA expression in mast cells and results in favorable modification of clinical conditions of allergic diseases.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:1437/CSF2
EntrezGene:20339/Sele
EntrezGene:21926/Tnf
EntrezGene:22329/Vcam1
EntrezGene:22339/Vegfa
EntrezGene:3565/IL4
EntrezGene:3567/IL5
EntrezGene:3569/IL6
EntrezGene:3576/IL8
EntrezGene:3586/IL10
EntrezGene:4312/MMP1
EntrezGene:51324/SPG21
EntrezGene:6850/SYK
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7422/VEGFA

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Tnf ENSMUSG00000024401 3,4

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0 chr5:91320567-91320588
4 chr17:35337153-35337173

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2518221.pdf AGGGCAACACCTTCAAGCTCT
1 PMC2518221.pdf CAGCTATTGCCGTCCGATTGAGA
2 PMC2518221.pdf TGCTGGCTTTGGGAGGTTTGAT
3 PMC2518221.pdf CCTGTAGCCCACGTCGTAGC
4 PMC2518221.pdf TTGACCTCAGCGCTGAGTTG
5 PMC2518221.pdf ACCCACACTTGTGCCCATCTA
Display recognized sequences in FASTA format