text2genome

About us

Related Links

Press Coverage

PubMed: 18974873    PubMedCentral: PMC2570612

Mutation of the zebrafish nucleoporin elys sensitizes tissue progenitors to replication stress.

Davuluri G, Gong W, Yusuff S, Lorent K, Muthumani M, Dolan AC, Pack M
PLoS genetics, , 2008

Abstract:

The recessive lethal mutation flotte lotte (flo) disrupts development of the zebrafish digestive system and other tissues. We show that flo encodes the ortholog of Mel-28/Elys, a highly conserved gene that has been shown to be required for nuclear integrity in worms and nuclear pore complex (NPC) assembly in amphibian and mammalian cells. Maternal elys expression sustains zebrafish flo mutants to larval stages when cells in proliferative tissues that lack nuclear pores undergo cell cycle arrest and apoptosis. p53 mutation rescues apoptosis in the flo retina and optic tectum, but not in the intestine, where the checkpoint kinase Chk2 is activated. Chk2 inhibition and replication stress induced by DNA synthesis inhibitors were lethal to flo larvae. By contrast, flo mutants were not sensitized to agents that cause DNA double strand breaks, thus showing that loss of Elys disrupts responses to selected replication inhibitors. Elys binds Mcm2-7 complexes derived from Xenopus egg extracts. Mutation of elys reduced chromatin binding of Mcm2, but not binding of Mcm3 or Mcm4 in the flo intestine. These in vivo data indicate a role for Elys in Mcm2-chromatin interactions. Furthermore, they support a recently proposed model in which replication origins licensed by excess Mcm2-7 are required for the survival of human cells exposed to replication stress.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:30590/tp53
EntrezGene:30637/mdm2
EntrezGene:192323/mcm3
EntrezGene:192338/mcm2
EntrezGene:336998/chek2
EntrezGene:337598/mcm4
EntrezGene:393162/chek1
EntrezGene:394048/h2afx
EntrezGene:553494/ahctf1
EntrezGene:100151416/cdkn1a
Species found in fulltext (Linnaeus)
Danio rerio
Homo sapiens
Mus musculus
Caenorhabditis elegans
Triticum aestivum
Schizosaccharomyces pombe
Saccharomyces cerevisiae
Oryctolagus cuniculus
Lawsonia intracellularis
Emericella nidulans
Armoracia rusticana
Genes found in fulltext (GNAT)
EntrezGene:11200/CHEK2
EntrezGene:25909/AHCTF1
EntrezGene:4171/MCM2
EntrezGene:4172/MCM3
EntrezGene:4173/MCM4
EntrezGene:4174/MCM5
EntrezGene:472/ATM
EntrezGene:7157/TP53

Best predicted genome from sequences: Danio rerio

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
ahctf1 ENSDARG00000077530 0,1,2,3,4,24,25,27,34,35
ahctf1 ENSDARG00000058060 9,10,11,12,13,14,15,23
tp53 ENSDARG00000035559 29,37
mdm2 ENSDARG00000033443 32,33

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
32, 33 chr4:22924561-22927220
30, 31 chr22:364437-364836
0, 1, 2, 6, 7, 8, 9, 11, 13, 14, 15, 16, 17, 18, 23, 24, 25, 27, 35, 36 chr17:10366052-10393843
20 chr17:10560700-10560722
28, 29, 38 chr5:22116845-22120031

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2570612.S9.doc TAGTAGTCGGCACGGCTTAACACTG
1 PMC2570612.S9.doc ACTCTGGTGTAGATGCTGTGTGCTG
2 PMC2570612.S9.doc TATCTCTCGTGTTGTCAAGGCTGTG
3 PMC2570612.S9.doc GCTGTAGCACATCATCATCATCGAA
4 PMC2570612.S9.doc AGAAGGCTTCGATGATGATGATGTG
5 PMC2570612.S9.doc AACTGAAATCCCATTGTTCCAGTGA
6 PMC2570612.S9.doc GAGCCGCATTACCTTCATAGAGGAT
7 PMC2570612.S9.doc GAGGCTCTAATGGAGGAGGAACACT
8 PMC2570612.S9.doc ATCTTGATACTCGGGACCCAACAG
9 PMC2570612.S9.doc ACACATACCATCTTCCTCATCCAGA
10 PMC2570612.S9.doc ACCTGAGGCACAGCTGAAAGTTCTA
11 PMC2570612.S9.doc TGTCTGCCTCAAGGTTAGGTACAGG
12 PMC2570612.S9.doc TTAACACAACCAAACAAGCAGCAAG
13 PMC2570612.S9.doc AAGAGCATCAGCTTGAGGAGATTCA
14 PMC2570612.S9.doc GGAAGTACACGCTGAATCTCCTCAA
15 PMC2570612.S9.doc TCCAGGCAGAGTTCATAATCAAAGC
16 PMC2570612.S9.doc CACAAAAGTGCTTCCCACTCACGTG
17 PMC2570612.S9.doc GAGAAGGCAAGTCCACAGTTGTGTTC
18 PMC2570612.S9.doc CACAAAAGTGCTTCCCACTCTCGGG
19 PMC2570612.S9.doc CTCGGGAGCAGGAGCATCATGAAATAA
20 PMC2570612.S9.doc GGATGAAAGTCAGAATTGCGTATAA
21 PMC2570612.S9.doc AAATTCAGGATGTTTAAATGCAAGAT
22 PMC2570612.S9.doc ATCAAAGCCTGCAAGTCCTGGAT
23 PMC2570612.S9.doc GGGATTTTCTGGTGCTGTGT
24 PMC2570612.S9.doc GATGGCAATCTGCAACTCTG
25 PMC2570612.S9.doc TGGCTCCTGGAAGGTAAATG
26 PMC2570612.S9.doc GAAACTGCCTCTTGGACTGG
27 PMC2570612.S9.doc GGAGGTAGTGGACCATGAGC
28 PMC2570612.S9.doc GTGGCTCTTGCTGGGACAT
29 PMC2570612.S9.doc GATGGCTGAGGCTGTTCTTC
30 PMC2570612.S9.doc TGAGAACTTACTGGCAGCTTCA
31 PMC2570612.S9.doc AGCTGCATTCGTCTCGTAGC
32 PMC2570612.S9.doc CAGGAGGAGGAGAAGCAGTG
33 PMC2570612.S9.doc AGGGAAAAGCTGTCCGACTT
34 PMC2570612.S9.doc ATGATGCCTACTGCGCGTTGATGACAAC
35 PMC2570612.S9.doc ACGTTACTTCAAACACGACTTTCGT
36 PMC2570612.S9.doc AAATATAAATTACCTGAGGTTTCCAT
37 PMC2570612.S9.doc ATGGCGCCATTGCTTTGCAAGAATTG
38 PMC2570612.S9.doc AAAATGTCTGTACTATCTCCATCCG
Display recognized sequences in FASTA format