text2genome

About us

Related Links

Press Coverage

PubMed: 20465837    PubMedCentral: PMC2875220

Expression analysis of genes associated with human osteosarcoma tumors shows correlation of RUNX2 overexpression with poor response to chemotherapy.

Sadikovic B, Thorner P, Chilton-Macneill S, Martin JW, Cervigne NK, Squire J, Zielenska M
BMC cancer, 202 , 2010

Abstract:

BACKGROUND: Human osteosarcoma is the most common pediatric bone tumor. There is limited understanding of the molecular mechanisms underlying osteosarcoma oncogenesis, and a lack of good diagnostic as well as prognostic clinical markers for this disease. Recent discoveries have highlighted a potential role of a number of genes including: RECQL4, DOCK5, SPP1, RUNX2, RB1, CDKN1A, P53, IBSP, LSAMP, MYC, TNFRSF1B, BMP2, HISTH2BE, FOS, CCNB1, and CDC5L. METHODS: Our objective was to assess relative expression levels of these 16 genes as potential biomarkers of osteosarcoma oncogenesis and chemotherapy response in human tumors. We performed quantitative expression analysis in a panel of 22 human osteosarcoma tumors with differential response to chemotherapy, and 5 normal human osteoblasts. RESULTS: RECQL4, SPP1, RUNX2, and IBSP were significantly overexpressed, and DOCK5, CDKN1A, RB1, P53, and LSAMP showed significant loss of expression relative to normal osteoblasts. In addition to being overexpressed in osteosarcoma tumor samples relative to normal osteoblasts, RUNX2 was the only gene of the 16 to show significant overexpression in tumors that had a poor response to chemotherapy relative to good responders. CONCLUSION: These data underscore the loss of tumor suppressive pathways and activation of specific oncogenic mechanisms associated with osteosarcoma oncogenesis, while drawing attention to the role of RUNX2 expression as a potential biomarker of chemotherapy failure in osteosarcoma.

Organism/Genes in external databases

Datasource Data

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
RUNX2 ENSG00000124813 0,1
DOCK5 ENSG00000147459 3,2
TNFRSF10A ENSG00000104689 4,5
HIST2H2BE ENSG00000184678 6,7
TP53 ENSG00000141510 8,9
CDKN1A ENSG00000124762 11,10
CCNB1 ENSG00000134057 12,13
BMP2 ENSG00000125845 14,15
IBSP ENSG00000029559 16,17
SPP1 ENSG00000118785 18,19
LSAMP ENSG00000185565 20,21
MYC ENSG00000136997 22,23
RECQL4 ENSG00000160957 24,25
CDC5L ENSG00000096401 26,27
RB1 ENSG00000139687 28,29
FOS ENSG00000170345 30,31
PGK1 ENSG00000102144 32,33

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
20, 21 chr3:115529213-115560781
16, 17 chr4:88727272-88731822
14, 15 chr20:6751009-6758928
22, 23 chr8:128751219-128752718
10, 11 chr6:36652283-36653580
6, 7 chr1:149814664-149858217
12, 13 chr5:68473118-68473384
18, 19 chr4:88902882-88903676
2 chr8:25042378-25042398
4, 5 chr8:23049477-23054703
0, 1 chr6:45512965-45514617
32, 33 chrX:77380861-77381355
26, 27 chr6:44413513-44414377
8, 9 chr17:7572966-7574007
3 chr8:25101214-25101234
30, 31 chr14:75745752-75746626
28, 29 chr13:49051517-49054231
24, 25 chr8:145739720-145740338

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2875220.S2.xls CCACCTCTGACTTCTGCCTC
1 PMC2875220.S2.xls ATGAAATGCTTGGGAACTGC
2 PMC2875220.S2.xls CTGTAGCAGCCTTAGTCGCC
3 PMC2875220.S2.xls GCAAGGAGAGCTCCACATCT
4 PMC2875220.S2.xls TGAAGGGTCTCAGAGGAGGA
5 PMC2875220.S2.xls GAGTCAAAGGGCACGATGTT
6 PMC2875220.S2.xls TAAGCCGCGTTTGTACTGTG
7 PMC2875220.S2.xls CGTCTTTCTTCTGGGCTTTG
8 PMC2875220.S2.xls GTTCCGAGAGCTGAATGAGG
9 PMC2875220.S2.xls TTATGGCGGGAGGTAGACTG
10 PMC2875220.S2.xls GACTCTCAGGGTCGAAAACG
11 PMC2875220.S2.xls GGATTAGGGCTTCCTCTTGG
12 PMC2875220.S2.xls TATGCAGCACCTGGCTAAGA
13 PMC2875220.S2.xls CATGCTTCGATGTGGCATAC
14 PMC2875220.S2.xls GCTAGACCTGTATCGCAGGC
15 PMC2875220.S2.xls GTTTTCCCACTCGTTTCTGG
16 PMC2875220.S2.xls GGGCAGTAGTGACTCATCCG
17 PMC2875220.S2.xls TTCTCAGCCTCAGAGTCTTCA
18 PMC2875220.S2.xls GCCGAGGTGATAGTGTGGTT
19 PMC2875220.S2.xls TGAGGTGATGTCCTCGTCTG
20 PMC2875220.S2.xls TGACCAACGTCACTGAGGAG
21 PMC2875220.S2.xls GTACGGCCAGACTGATGGAT
22 PMC2875220.S2.xls CTGGTGCTCCATGAGGAGA
23 PMC2875220.S2.xls CTCTGACCTTTTGCCAGGAG
24 PMC2875220.S2.xls GTCACTCATGGATGACCAGG
25 PMC2875220.S2.xls AGCACGTGTACCTGGGCTG
26 PMC2875220.S2.xls ATGGGACCAAATTGAACAGG
27 PMC2875220.S2.xls TTTCTTGTTGTCGCTGAACG
28 PMC2875220.S2.xls TCAGCAGAAACTGGCAGAAA
29 PMC2875220.S2.xls GTGTCCACCAAGGTCCTGAG
30 PMC2875220.S2.xls CCGGGGATAGCCTCTCTTAC
31 PMC2875220.S2.xls GTGGGAATGAAGTTGGCACT
32 PMC2875220.S2.xls ACGGAGGATAAAGTCAGCCA
33 PMC2875220.S2.xls TGCACAGGAACTAAAAGGCA
Display recognized sequences in FASTA format