text2genome

About us

Related Links

Press Coverage

PubMed: 18680601    PubMedCentral: PMC2575589

Downregulation of protein disulfide isomerase in sepsis and its role in tumor necrosis factor-alpha release.

Zhou M, Jacob A, Ho N, Miksa M, Wu R, Maitra SR, Wang P
Critical care (London, England), R100 , 2008

Abstract:

INTRODUCTION: Protein disulfide isomerase (PDI) is an important factor for the protein modification step in the post-translational event. PDI plays an essential role in cell survival under various stress conditions. It has been reported that PDI can serve as a negative regulator of nuclear factor-kappa-B (NF-kappaB) and that it can inhibit lipopolysaccharide (LPS)-induced proinflammatory cytokine production in macrophages. Thus, PDI may be an intracellular anti-inflammatory molecule. Although we have previously shown that Kupffer cell-derived proinflammatory cytokines cause liver injury in sepsis, the effect of sepsis on PDI expression as well as the effect of PDI inhibition on cytokine production have not been investigated. We therefore hypothesized that sepsis downregulates PDI expression and that the inhibition of PDI promotes proinflammatory cytokine production. METHOD: Adult male rats were subjected to sepsis by cecal ligation and puncture (CLP) or endotoxemia (continuous infusion of 1 microg/kg body weight LPS by an osmotic pump) for 20 hours. Hepatic tissues were collected and PDI gene expression was determined. In additional experiments, cells from a macrophage-like cell line, RAW 264.7, were treated with 100 ng/mL LPS for 4 hours and protein expressions were measured. RAW 264.7 cells were also treated with bacitracin, a specific PDI inhibitor, for 24 hours, and tumor necrosis factor-alpha (TNF-alpha) gene and protein expression as well as its release in the cell supernatant were determined. To further confirm the beneficial effect of PDI in sepsis, RAW 264.7 cells were transfected with PDI short interfering RNA (siRNA) and PDI gene expression and TNF-alpha release were measured by quantitative polymerase chain reaction and enzyme-linked immunosorbent assay, respectively. RESULTS: PDI gene expression was significantly decreased by 28% and 69% at 20 hours after CLP or LPS infusion, respectively. LPS also decreased PDI protein expression by 33% in RAW 264.7 cells. Incubation of RAW 264.7 cells with bacitracin significantly increased TNF-alpha gene expression and TNF-alpha release as well as its cellular levels in a dose-dependent manner. Transfection of RAW 264.7 cells with PDI siRNA produced an average 36.8% inhibition of the PDI gene expression. This downregulation was correlated with a 3.19-fold increase in TNF-alpha release into the cell supernatant. CONCLUSION: Taken together, these results suggest that downregulation of PDI by sepsis significantly increases proinflammatory cytokine production. Thus, prevention of PDI downregulation in sepsis may be a novel approach to attenuate hyperinflammation and to reduce tissue injury under such conditions.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:107146/Glyat
EntrezGene:12826/Col4a1
EntrezGene:18453/P4hb
EntrezGene:21926/Tnf
EntrezGene:24835/TNFA_RAT
EntrezGene:24837/TNNT2_RAT
EntrezGene:25506/PDIA1_RAT
EntrezGene:314323/FLVC2_RAT
EntrezGene:64177/Trpv6

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
P4hb ENSMUSG00000025130 1,8
Actb ENSMUSG00000029580 3,7
Tnf ENSMUSG00000024401 4,5

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
4 chr11:4097339-4097422
3, 7 chr16:37883216-37883581
1 chr11:120423736-120423756
4 chr17:35338820-35338842

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2575589.pdf CTACGATGGCAAATTGAGCA
1 PMC2575589.pdf CTTCCACCTCATTGGCTGTT
2 PMC2575589.pdf TTGTAACCAACTGGGACGATATGG
3 PMC2575589.pdf GATCTTGATCTTCATGGTGCTAGG
4 PMC2575589.pdf TTCTGTCCCTTTCACTCACTGG
5 PMC2575589.pdf TTGGTGGTTTGCTACGACGTGG
6 PMC2575589.pdf GTGGGCCGCTCTAGGCACCAA
7 PMC2575589.pdf CTCTTTGATGTCACGCACGATTTC
8 PMC2575589.pdf TACCTGCTGGTGGAGTTCTATGC
Display recognized sequences in FASTA format