text2genome

About us

Related Links

Press Coverage

PubMed: 18334933    PubMedCentral: PMC2254959

Expression of senescence-related genes in human corneal endothelial cells.

Song Z, Wang Y, Xie L, Zang X, Yin H
Molecular vision, 161 , 2008

Abstract:

PURPOSE: To investigate the expression of p16(INK4a), p21(WAF1/CIP1), p27(KIP1), and p53 in human corneal endothelial cell (HCEC) senescence ex vivo at various donor ages. METHODS: Residual corneal tissues obtained after penetrating keratoplasty were used in this study. Age, death-to-preservation interval, and preservation-to-surgery interval of the donors were recorded. Corneal endothelial cell survival and density were evaluated by trypan blue and alizarin red staining immediately after keratoplasty. Fresh frozen sections of donor corneas at various ages (18, 33, 54, and 68 years) were immunostained in situ. Total RNA extracted from age groups of 20, 30, 40, 50, and 60 years was evaluated by reverse-transcriptase polymerase chain reaction (PCR) to reveal the expression of the senescence-related genes, p16(INK4a), p21(WAF1/CIP1), p27(KIP1), and p53, in HCECs. Total RNA extracted from 20-, 24-, 26-, 30-, 50-, 55-, 56-, and 60-year-old donor groups was subjected to real-time PCR analysis for measurement of gene expression. The results of the young (< or =30 years) and the old (> or = 50 years) were compared by the unpaired t-test. Ex vivo senescence of HCECs from the donors at various ages (9, 17, 23, 57, 65, and 67 years) was observed by senescence-associated beta-galactosidase activity (SA-beta-Gal) staining at pH 6.0. RESULTS: The mean endothelial cell density of the donor corneas was 2,391.4+/-84.6 cells/mm(2), and the survival rate of the endothelial cells was 84.4%+/-5.3%. Hematoxylin and eosin staining showed normal structures of the corneal epithelium, stroma, and endothelium. The expression and nuclear localization of p16(INK4a), p21(WAF1/CIP1), p27(KIP1), and p53 in HCECs were confirmed by immunohistochemistry in situ. Reverse transcriptase PCR examination showed positive target bands of each gene at each age group. An age-related increase in p16(INK4a) expression was observed by real-time PCR (p=0.014). There was no significant difference in the expression levels of p21(WAF1/CIP1), p27(KIP1), and p53 between the young and old donors (p=0.875, 0.472, and 0.430, respectively). Strong SA-beta-Gal activity was observed in the endothelial cells of the old donors while there was weak and little-to-no blue staining in the endothelia from the young. CONCLUSIONS: The population of HCECs exhibiting senescence-like characteristics increases with age. p16(INK4a), p21(WAF1/CIP1), p27(KIP1), and p53 are expressed in HCECs despite donor ages. The p16(INK4a) signal pathway might play a key role in the process of senescence in HCECs.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:1026/CDKN1A
EntrezGene:1027/CDKN1B
EntrezGene:1029/CDKN2A
EntrezGene:7157/TP53
Genes found in fulltext (GNAT)
EntrezGene:1026/CDKN1A
EntrezGene:1027/CDKN1B
EntrezGene:1029/CDKN2A
EntrezGene:2597/GAPDH
EntrezGene:3815/KIT
EntrezGene:7157/TP53
EntrezGene:7462/LAT2
EntrezGene:941/CD80
EntrezGene:983/CDC2

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
CDKN2A ENSG00000147889 0,1,10,11
CDKN1A ENSG00000124762 2,3,13,14,15
SSSCA1 ENSG00000173465 4,5,16,17,18
TP53 ENSG00000141510 6,7,19,20,21
GAPDH ENSG00000111640 8,9,22,23

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
4, 5, 16, 18 chr11:65338361-65339047
8, 9, 22, 23 chr12:6646114-6647305
2, 3, 14, 15 chr6:36652045-36653577
6, 19, 20 chr17:7572592-7576918
0, 1, 11 chr9:21968044-21968242

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2254959.pdf GACATCCCCGATTGAAAGAA
1 PMC2254959.pdf TTTACGGTAGTGGGGGAAGG
2 PMC2254959.pdf GACACCACTGGAGGGTGACT
3 PMC2254959.pdf CAGGTCCACATGGTCTTCCT
4 PMC2254959.pdf TCTACTGCGTGGCTTGTCAG
5 PMC2254959.pdf CTGTATTTGGAGGCACAGCA
6 PMC2254959.pdf GGCCCACTTCACCGTACTAA
7 PMC2254959.pdf GTGGTTTCAAGGCCAGATGT
8 PMC2254959.pdf ACCACAGTCCATGCCATCAC
9 PMC2254959.pdf TCCACCACCCTGTTGCTGTA
10 PMC2254959.pdf AAGGTCCCTCAGACATCCC
11 PMC2254959.pdf TGTAGGACCTTCGGTGACTG
12 PMC2254959.pdf TCCGGAGGTTTCTCAGAGCCTCTC
13 PMC2254959.pdf CAGACCAGCATGACAGATTTC
14 PMC2254959.pdf TTAGGGCTTCCTCTTGGAGA
15 PMC2254959.pdf ACCACTCCAAACGCCGGCTG
16 PMC2254959.pdf CCTCCTCCAAGACAAACAGC
17 PMC2254959.pdf CATTCAGAGCGGGATTATCTTT
18 PMC2254959.pdf TCGAGTTCCTGACAAGCCACGC
19 PMC2254959.pdf AACAACACCAGCTCCTCTCC
20 PMC2254959.pdf CTCATTCAGCTCTCGGAACA
21 PMC2254959.pdf CCCTTCAGATCCGTGGGCGT
22 PMC2254959.pdf ATGCTGGCGCTGAGTACGT
23 PMC2254959.pdf TGGAGTCCACTGGCGTCTTCA
Display recognized sequences in FASTA format