text2genome

About us

Related Links

Press Coverage

PubMed: 19267931    PubMedCentral: PMC2663549

Hypoxia regulates human lung fibroblast proliferation via p53-dependent and -independent pathways.

Mizuno S, Bogaard HJ, Voelkel NF, Umeda Y, Kadowaki M, Ameshima S, Miyamori I, Ishizaki T
Respiratory research, 17 , 2009

Abstract:

BACKGROUND: Hypoxia induces the proliferation of lung fibroblasts in vivo and in vitro. However, the subcellular interactions between hypoxia and expression of tumor suppressor p53 and cyclin-dependent kinase inhibitors p21 and p27 remain unclear. METHODS: Normal human lung fibroblasts (NHLF) were cultured in a hypoxic chamber or exposed to desferroxamine (DFX). DNA synthesis was measured using bromodeoxyuridine incorporation, and expression of p53, p21 and p27 was measured using real-time RT-PCR and Western blot analysis. RESULTS: DNA synthesis was increased by moderate hypoxia (2% oxygen) but was decreased by severe hypoxia (0.1% oxygen) and DFX. Moderate hypoxia decreased p21 synthesis without affecting p53 synthesis, whereas severe hypoxia and DFX increased synthesis of both p21 and p53. p27 protein expression was decreased by severe hypoxia and DFX. Gene silencing of p21 and p27 promoted DNA synthesis at ambient oxygen concentrations. p21 and p53 gene silencing lessened the decrease in DNA synthesis due to severe hypoxia or DFX exposure. p21 gene silencing prevented increased DNA synthesis in moderate hypoxia. p27 protein expression was significantly increased by p53 gene silencing, and was decreased by wild-type p53 gene transfection. CONCLUSION: These results indicate that in NHLF, severe hypoxia leads to cell cycle arrest via the p53-p21 pathway, but that moderate hypoxia enhances cell proliferation via the p21 pathway in a p53-independent manner. In addition, our results suggest that p27 may be involved in compensating for p53 in cultured NHLF proliferation.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:7157/TP53
Genes found in fulltext (GNAT)
EntrezGene:1026/CDKN1A
EntrezGene:1029/CDKN2A
EntrezGene:3265/HRAS
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:9531/BAG3

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
CDKN1A ENSG00000124762 0,1
CDKN1B ENSG00000111276 2,3
TP53 ENSG00000141510 4,5
ACTB ENSG00000075624 6,7

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
7 chr15:34665652-34665672
6 chr7:5567414-5567434
6 chr18:60110306-60110326
0, 1 chr6:36652198-36653548
6 chr1:27652231-27652251
2, 3 chr12:12874599-12874708
4, 5 chr17:7572966-7574007
6 chr3:175695316-175695336

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2663549.pdf GGAAGACCATGTGGACCTGT
1 PMC2663549.pdf GGCGTTTGGAGTGGTAGAAA
2 PMC2663549.pdf GCCCTCCCCAGTCTCTCTTA
3 PMC2663549.pdf TCAAAACTCCCAAGCACCTC
4 PMC2663549.pdf GTTCCGAGAGCTGAATGAGG
5 PMC2663549.pdf TTATGGCGGGAGGTAGACTG
6 PMC2663549.pdf GCAAGCAGGAGTATGACGAG
7 PMC2663549.pdf CAAATAAAGCCATGCCAATC
8 PMC2663549.pdf CGTCAGAACCCATGCGGCAGGAGCAATGCGCAGGAATACTGGAAGACTCCAGTGGTA
9 PMC2663549.pdf ATCCGCGCGATAGTACGTA
Display recognized sequences in FASTA format