text2genome

About us

Related Links

Press Coverage

PubMed: 19247457    PubMedCentral: PMC2647972

Anti-inflammatory effect of pigment epithelium-derived factor in DBA/2J mice.

Zhou X, Li F, Kong L, Chodosh J, Cao W
Molecular vision, 438 , 2009

Abstract:

PURPOSE: Glaucoma is the second leading cause of blindness. The ultimate cause of vision loss in glaucoma is thought to be retinal ganglion cell (RGC) death. Neuroprotection of RGC is therefore an important goal of glaucoma therapy. Several lines of evidence suggest that pigment epithelium derived factor (PEDF) is a potent anti-angiogenic, neuroprotective, and anti-inflammatory factor for neurons. In this study, we examined the potential role of PEDF in protection of RGC in the DBA/2J mouse, an animal model of inherited glaucoma. METHODS: DBA/2J mice at two months of age were transfected intravitreally with adeno-associated virus (AAV)-PEDF or AAV-green fluorescent protein (AAV-GFP). RGC and nerve fiber layer protection were evaluated in retinal cross sections. Biochemical alterations in the retinas of DBA/2J mice in response to intravitreal transfection of PEDF were also examined by reverse transcriptase PCR (RT-PCR) and western blot. Cellular localization of PEDF and glial fibrillary acidic protein (GFAP) was determined by immunohistochemistry. Visual acuity was determined by optomotor testing. RESULTS: PEDF protein levels in the retina and optic nerves of DBA/2J mice declined with age. The expression of tumor necrosis factor (TNF), GFAP, and interleukin-18 (IL-18) increased with age in the retina and optic nerve of DBA/2J mice. Intravitreal PEDF transfection in DBS/2J mice reduced loss of RGC and nerve fiber layer, delayed vision loss, and reduced TNF, IL-18, and GFAP expression in the retina and optic nerve. CONCLUSIONS: Transduced PEDF potently and efficaciously reduces RGC loss and vision decline in DBA/2J mice, possibly via the reduction of TNF and IL-18, and downregulation of GFAP. The anti-inflammatory effect of PEDF represents a novel approach to the prevention of glaucomatous RGC death.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:5176/SERPINF1
Genes found in fulltext (GNAT)
EntrezGene:14580/Gfap
EntrezGene:16173/Il18
EntrezGene:20317/Serpinf1
EntrezGene:21926/Tnf
EntrezGene:2641/GCG
EntrezGene:2670/GFAP
EntrezGene:2678/GGT1
EntrezGene:3606/IL18
EntrezGene:4350/MPG
EntrezGene:5176/SERPINF1
EntrezGene:5265/SERPINA1
EntrezGene:6223/RPS19P3
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:788/SLC25A20

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Serpinf1 ENSMUSG00000000753 0,1
Tnf ENSMUSG00000024401 2,3
Il18 ENSMUSG00000039217 4,5

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0 chr11:75229157-75229181
2, 3 chr17:35336818-35337331
4, 5 chr9:50385879-50389870

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2647972.pdf TGATCACCAACCCTGACATCCACA
1 PMC2647972.pdf GCTGGGCAATCTTGCAGTTGAGAT
2 PMC2647972.pdf ACACCGTCAGCCGATTTGCTATCT
3 PMC2647972.pdf TGGACATTCGAGGCTCCAGTGAAT
4 PMC2647972.pdf GACAACTTTGGCCGACTTCACTGT
5 PMC2647972.pdf CACAAGGCGCATGTGTGCTAATCA
Display recognized sequences in FASTA format