text2genome

About us

Related Links

Press Coverage

PubMed: 20454633    PubMedCentral: PMC2862961

Normal human gingival epithelial cells sense C. parapsilosis by toll-like receptors and module its pathogenesis through antimicrobial peptides and proinflammatory cytokines.

Bahri R, Curt S, Saidane-Mosbahi D, Rouabhia M
Mediators of inflammation, , 2010

Abstract:

This study was designed to investigate the interaction between C. parapsilosis and human epithelial cells using monolayer cultures and an engineered human oral mucosa (EHOM). C. parapsilosis was able to adhere to gingival epithelial cells and to adopt the hyphal form in the presence of serum. Interestingly, when cultured onto the engineered human oral mucosa (EHOM), C. parapsilosis formed small biofilm and invaded the connective tissue. Following contact with C. parapsilosis, normal human gingival epithelial cells expressed high levels of Toll-like receptors (TLR)-2, -4, and -6, but not TLR-9 mRNA. The upregulation of TLRs was paralleled by an increase of IL-1beta, TNFalpha, and IFNgamma mRNA expression, suggesting the involvement of these cytokines in the defense against infection with C. parapsilosis. The active role of epithelial cells in the innate immunity against C. parapsilosis infection was enhanced by their capacity to express high levels of human beta-defensin-1, -2, and -3. The upregulation of proinflammatory cytokines and antimicrobial peptide expression may explain the growth inhibition of C. parapsilosis by the gingival epithelial cells. Overall results provide additional evidence of the involvement of epithelial cells in the innate immunity against C. parapsilosis infections.

Organism/Genes in external databases

Datasource Data

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TLR2 ENSG00000137462 0,1
TLR4 ENSG00000136869 3,2
TWF2 ENSG00000173366 6,7
DEFB4 ENSG00000171711 10,11
DEFB103B ENSG00000176797 12,13
DEFB103A ENSG00000177243 12,13
IL1B ENSG00000125538 16,17
IFNG ENSG00000111537 18,19
TNF ENSG00000204490 20,21
TNF ENSG00000206439 20,21
TNF ENSG00000223952 20,21
TNF ENSG00000228321 20,21
TNF ENSG00000228849 20,21
TNF ENSG00000230108 20,21
TNF ENSG00000232810 20,21

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
20, 21 HSCHR6_MHC_MANN:31583103-31583832
23 chr15:64821180-64821204
18, 19 chr12:68551787-68551994
20, 21 HSCHR6_MHC_MCF:31619925-31620654
20, 21 HSCHR6_MHC_COX:31531028-31531757
23 chr6:166478445-166478469
9 chr8:6735343-6735367
2, 3 chr9:120474931-120475047
20, 21 HSCHR6_MHC_SSTO:31533559-31534288
0, 1 chr4:154624105-154624249
23 chr1:120004964-120004988
16, 17 chr2:113588125-113588913
10, 11, 12, 13 chr8:7738958-7754198
20, 21 HSCHR6_MHC_DBB:31525760-31526489
23 chrX:46299456-46299480
14, 15 chr8:7570138-7631437
6, 7 chr3:52255658-52255809
4 chr4:38830719-38830743
20, 21 HSCHR6_MHC_QBL:31533857-31534588
23 chrX:39646698-39646722
23 chr12:6646892-6646916
10, 11, 12, 13 chr8:7272416-7287637
20, 21 chr6:31543616-31544345

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2862961.pdf GCCTCTCCAAGGAAGAATCC
1 PMC2862961.pdf TCCTGTTGTTGGACAGGTCA
2 PMC2862961.pdf AATCTAGAGCACTTGGACCTTTCC
3 PMC2862961.pdf GGGTTCAGGGACAGGTCTAAAGA
4 PMC2862961.pdf CATCCTATTGTGAGTTTCAGGCAT
5 PMC2862961.pdf GCTTCATAGCACTACATCCCAAG
6 PMC2862961.pdf GGACCTCTGGTACTGCTTCCA
7 PMC2862961.pdf AAGCTCGTTGTACACCCAGTCT
8 PMC2862961.pdf GCCTCTCCCCAGTTCCTGAA
9 PMC2862961.pdf GCAGAGAGTAAACAGCAGAAGGTA
10 PMC2862961.pdf TGTGGTCTCCCTGGAACAAAAT
11 PMC2862961.pdf GTCGCACGTCTCTGATGAGG
12 PMC2862961.pdf CTTCTGTTTGCTTTGCTCTTCCT
13 PMC2862961.pdf CTGTTCCTCCTTTGGAAGGCA
14 PMC2862961.pdf CACTCTACCAACACGCACCTAG
15 PMC2862961.pdf CGCAACTGGAACCACACACT
16 PMC2862961.pdf CTGTCCTGCGTGTTGAAAGA
17 PMC2862961.pdf TTGGGTAATTTTTGGGATCTACA
18 PMC2862961.pdf GGCATTTTGAAGAATTGGAAAG
19 PMC2862961.pdf TTTGGATGCTCTGGTCATCTT
20 PMC2862961.pdf CAGCCTCTTCTCCTTCCTGAT
21 PMC2862961.pdf GCCAGAGGGCTGATTAGAGA
22 PMC2862961.pdf GGTATCGTCGAAGGACTCATGAC
23 PMC2862961.pdf ATGCCAGTGAGCTTCCCGTTCAGC
Display recognized sequences in FASTA format