text2genome

About us

Related Links

Press Coverage

PubMed: 17080328    PubMedCentral: PMC2799004

Mitochondrial control of cell death induced by hyperosmotic stress.

Criollo A, Galluzzi L, Maiuri MC, Tasdemir E, Lavandero S, Kroemer G
Apoptosis : an international journal on programmed cell death, 3 , 2007

Abstract:

HeLa and HCT116 cells respond differentially to sorbitol, an osmolyte able to induce hypertonic stress. In these models, sorbitol promoted the phenotypic manifestations of early apoptosis followed by complete loss of viability in a time-, dose-, and cell type-specific fashion, by eliciting distinct yet partially overlapping molecular pathways. In HCT116 but not in HeLa cells, sorbitol caused the mitochondrial release of the caspase-independent death effector AIF, whereas in both cell lines cytochrome c was retained in mitochondria. Despite cytochrome c retention, HeLa cells exhibited the progressive activation of caspase-3, presumably due to the prior activation of caspase-8. Accordingly, caspase inhibition prevented sorbitol-induced killing in HeLa, but only partially in HCT116 cells. Both the knock-out of Bax in HCT116 cells and the knock-down of Bax in A549 cells by RNA interference reduced the AIF release and/or the mitochondrial alterations. While the knock-down of Bcl-2/Bcl-X(L) sensitized to sorbitol-induced killing, overexpression of a Bcl-2 variant that specifically localizes to mitochondria (but not of the wild-type nor of a endoplasmic reticulum-targeted form) strongly inhibited sorbitol effects. Thus, hyperosmotic stress kills cells by triggering different molecular pathways, which converge at mitochondria where pro- and anti-apoptotic members of the Bcl-2 family exert their control.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:12043/Bcl2
EntrezGene:12048/Bcl2l1
EntrezGene:12367/Casp3
EntrezGene:1537/CYC1
EntrezGene:22059/Trp53
EntrezGene:24224/BCL2_RAT
EntrezGene:24383/G3P_RAT
EntrezGene:24842/P53_RAT
EntrezGene:24887/BAX_RAT
EntrezGene:24888/B2CL1_RAT
EntrezGene:24888/NP_001028843.1
EntrezGene:2597/GAPDH
EntrezGene:308/ANXA5
EntrezGene:317/APAF1
EntrezGene:3329/HSPD1
EntrezGene:355/FAS
EntrezGene:356/FASLG
EntrezGene:4170/MCL1
EntrezGene:578/BAK1
EntrezGene:581/BAX
EntrezGene:596/BCL2
EntrezGene:598/BCL2L1
EntrezGene:63868/CH60_RAT
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7157/TP53
EntrezGene:7416/VDAC1
EntrezGene:8772/FADD
EntrezGene:9131/AIFM1

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TP53 ENSG00000141510 4,5
VDAC1 ENSG00000213585 6,7

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
7 chr5:133326746-133326766
7 chrX:91238288-91238308
1 chr18:60985527-60985547

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2799004.pdf GCTGCACCTGACGCCCTTCTT
1 PMC2799004.pdf GAAGGGCGTCAGGTGCAGCTT
2 PMC2799004.pdf CAGGGACAGCATATCAGAGTT
3 PMC2799004.pdf CTCTGATATGCTGTCCCTGTT
4 PMC2799004.pdf GACTCCAGTGGTAATCTACTT
5 PMC2799004.pdf GTAGATTACCACTGGAGTCTT
6 PMC2799004.pdf GTACGGCCTGACGTTTACATT
7 PMC2799004.pdf TGTAAACGTCAGGCCGTACTT
8 PMC2799004.pdf GCCGGTATGCCGGTTAAGTTT
9 PMC2799004.pdf ACTTAACCGGCATACCGGCTTA
Display recognized sequences in FASTA format