text2genome

About us

Related Links

Press Coverage

PubMed: 19513120    PubMedCentral: PMC2688760

Cannabinoid CB2 receptor potentiates obesity-associated inflammation, insulin resistance and hepatic steatosis.

Deveaux V, Cadoudal T, Ichigotani Y, Teixeira-Clerc F, Louvet A, Manin S, Nhieu JT, Belot MP, Zimmer A, Even P, Cani PD, Knauf C, Burcelin R, Bertola A, Le Marchand-Brustel Y, Gual P, Mallat A, Lotersztajn S
PloS one, , 2009

Abstract:

BACKGROUND: Obesity-associated inflammation is of critical importance in the development of insulin resistance and non-alcoholic fatty liver disease. Since the cannabinoid receptor CB2 regulates innate immunity, the aim of the present study was to investigate its role in obesity-induced inflammation, insulin resistance and fatty liver. METHODOLOGY: Murine obesity models included genetically leptin-deficient ob/ob mice and wild type (WT) mice fed a high fat diet (HFD), that were compared to their lean counterparts. Animals were treated with pharmacological modulators of CB2 receptors. Experiments were also performed in mice knock-out for CB2 receptors (Cnr2 -/-). PRINCIPAL FINDINGS: In both HFD-fed WT mice and ob/ob mice, Cnr2 expression underwent a marked induction in the stromal vascular fraction of epididymal adipose tissue that correlated with increased fat inflammation. Treatment with the CB2 agonist JWH-133 potentiated adipose tissue inflammation in HFD-fed WT mice. Moreover, cultured fat pads isolated from ob/ob mice displayed increased Tnf and Ccl2 expression upon exposure to JWH-133. In keeping, genetic or pharmacological inactivation of CB2 receptors decreased adipose tissue macrophage infiltration associated with obesity, and reduced inductions of Tnf and Ccl2 expressions. In the liver of obese mice, Cnr2 mRNA was only weakly induced, and CB2 receptors moderately contributed to liver inflammation. HFD-induced insulin resistance increased in response to JWH-133 and reduced in Cnr2 -/- mice. Finally, HFD-induced hepatic steatosis was enhanced in WT mice treated with JWH-133 and blunted in Cnr2 -/- mice. CONCLUSION/SIGNIFICANCE: These data unravel a previously unrecognized contribution of CB2 receptors to obesity-associated inflammation, insulin resistance and non-alcoholic fatty liver disease, and suggest that CB2 receptor antagonists may open a new therapeutic approach for the management of obesity-associated metabolic disorders.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:12802/Cnr2
EntrezGene:16846/Lep
Genes found in fulltext (GNAT)
EntrezGene:1268/CNR1
EntrezGene:1269/CNR2
EntrezGene:12801/Cnr1
EntrezGene:12802/Cnr2
EntrezGene:13733/Emr1
EntrezGene:15370/Nr4a1
EntrezGene:16846/Lep
EntrezGene:2015/EMR1
EntrezGene:20296/Ccl2
EntrezGene:21926/Tnf
EntrezGene:55748/CNDP2
EntrezGene:6347/CCL2
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:9370/ADIPOQ

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Cnr2 ENSMUSG00000062585 0,1,6,7
Cnr1 ENSMUSG00000044288 2,3,8,9
Emr1 ENSMUSG00000004730 12,13
Tnf ENSMUSG00000024401 14,15

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
4 chr6:3151434-3151456
14 chr17:35338052-35338074
11 chr11:81850034-81850053
4 chr17:39984290-39984312
2, 3, 8, 9 chr4:34012042-34030813
12 chr17:57589446-57589468
0, 1, 6, 7 chr4:135451471-135473453

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2688760.pdf CTGTGCTGCTCATATGCTGG
1 PMC2688760.pdf GCAGAGCGAATCTCTCCACT
2 PMC2688760.pdf CTCCTGGCACCTCTTTCTCAG
3 PMC2688760.pdf GTCTCCTGCTGGAACCAACGG
4 PMC2688760.pdf ACCAGAGCGAAAGCATTTGCCA
5 PMC2688760.pdf ATCGCCAGTCGGCATCGTTTAT
6 PMC2688760.pdf GGATACAGAATAGCCAGGAC
7 PMC2688760.pdf GGAGCCGTTGGTCACTTCTG
8 PMC2688760.pdf GGGCAAATTTCCTTGTAGCA
9 PMC2688760.pdf CTGCAAGGCCGTCTAAGATCGACT
10 PMC2688760.pdf GGGCCTGCTGTTCACAGTT
11 PMC2688760.pdf CCAGCCTACTCATTGGGAT
12 PMC2688760.pdf CTTTGGCTATGGGCTTCCAGTC
13 PMC2688760.pdf GCAAGGAGGACAGAGTTTATCGTG
14 PMC2688760.pdf AATGGCCTCCCTCTCATCAGTT
15 PMC2688760.pdf CCACTTGGTGGTTTGCTACGA
Display recognized sequences in FASTA format