text2genome

About us

Related Links

Press Coverage

PubMed: 20398418    PubMedCentral: PMC2861659

Genetic polymorphisms of MDM2 and TP53 genes are associated with risk of nasopharyngeal carcinoma in a Chinese population.

Xiao M, Zhang L, Zhu X, Huang J, Jiang H, Hu S, Liu Y
BMC cancer, 147 , 2010

Abstract:

BACKGROUND: The tumor suppressor TP53 and its negative regulator MDM2 play crucial roles in carcinogenesis. Previous case-control studies also revealed TP53 72Arg>Pro and MDM2 309T>G polymorphisms contribute to the risk of common cancers. However, the relationship between these two functional polymorphisms and nasopharyngeal carcinoma (NPC) susceptibility has not been explored. METHODS: In this study, we performed a case-control study between 522 NPC patients and 722 healthy controls in a Chinese population by using PCR-RFLP. RESULTS: We found an increased NPC risk associated with the MDM2 GG (odds ratio [OR] = 2.83, 95% confidence interval [CI] = 2.08-3.96) and TG (OR = 1.49, 95% CI = 1.16-2.06) genotypes. An increased risk was also associated with the TP53 Pro/Pro genotype (OR = 2.22, 95% CI = 1.58-3.10) compared to the Arg/Arg genotype. The gene-gene interaction of MDM2 and TP53 polymorphisms increased adult NPC risk in a more than multiplicative manner (OR for the presence of both MDM2 GG and TP53 Pro/Pro genotypes = 7.75, 95% CI = 3.53-17.58). CONCLUSION: The findings suggest that polymorphisms of MDM2 and TP53 genes may be genetic modifier for developing NPC.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:4193/MDM2
EntrezGene:7157/TP53

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TP53 ENSG00000141510 0,1
MDM2 ENSG00000135679 6,7
ACTB ENSG00000075624 8,9

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
3, 4, 5, 6 chr12:69202451-69229642
0, 1 chr17:7579385-7579584
8, 9 chr7:5567404-5567718

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2861659.pdf TTGCCGTCCCAAGCAATGGATGA
1 PMC2861659.pdf TCTGGGAAGGGACAGAAGATGAC
2 PMC2861659.pdf GGGGGCCGGGGGCTGCGGGGCCGTTT
3 PMC2861659.pdf TGCCCACTGAACCGGCCCAATCCCGCCCAG
4 PMC2861659.pdf GGCAGTCGCCGCCAGGGAGGAGGGCGG
5 PMC2861659.pdf ACCTGCGATCATCCGGACCTCCCGCGCTGC
6 PMC2861659.pdf TGTAAGTGAACATTCAGGTG
7 PMC2861659.pdf TTCCAATAGTCAGCTAAGGA
8 PMC2861659.pdf GGCGGCACCACCATGTACCCT
9 PMC2861659.pdf AGGGGCCGGACTCGTCATACT
Display recognized sequences in FASTA format