text2genome

About us

Related Links

Press Coverage

PubMed: 18426864    PubMedCentral: PMC2453617

Blockade of alpha4 integrin signaling ameliorates the metabolic consequences of high-fat diet-induced obesity.

FĂ©ral CC, Neels JG, Kummer C, Slepak M, Olefsky JM, Ginsberg MH
Diabetes, 1842 , 2008

Abstract:

OBJECTIVE: Many prevalent diseases of advanced societies, such as obesity-induced type 2 diabetes, are linked to indolent mononuclear cell-dependent inflammation. We previously proposed that blockade of alpha4 integrin signaling can inhibit inflammation while limiting mechanism-based toxicities of loss of alpha4 function. Thus, we hypothesized that mice bearing an alpha4(Y991A) mutation, which blocks signaling, would be protected from development of high-fat diet-induced insulin resistance. RESEARCH DESIGN AND METHODS: Six- to eight-week-old wild-type and alpha4(Y991A) C57Bl/6 male mice were placed on either a high-fat diet that derived 60% calories from lipids or a chow diet. Metabolic testing was performed after 16-22 weeks of diet. RESULTS: Alpha4(Y991A) mice were protected from development of high-fat diet-induced insulin resistance. This protection was conferred on wild-type mice by alpha4(Y991A) bone marrow transplantation. In the reverse experiment, wild-type bone marrow renders high-fat diet-fed alpha4(Y991A) acceptor animals insulin resistant. Furthermore, fat-fed alpha4(Y991A) mice showed a dramatic reduction of monocyte/macrophages in adipose tissue. This reduction was due to reduced monocyte/macrophage migration rather than reduced monocyte chemoattractant protein-1 production. CONCLUSIONS: Alpha4 integrins contribute to the development of HFD-induced insulin resistance by mediating the trafficking of monocytes into adipose tissue; hence, blockade of alpha4 integrin signaling can prevent the development of obesity-induced insulin resistance.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:11450/Adipoq
EntrezGene:16193/Il6
EntrezGene:16401/Itga4
EntrezGene:16846/Lep
EntrezGene:20296/Ccl2
EntrezGene:21926/Tnf
EntrezGene:57264/Retn
Genes found in fulltext (GNAT)
EntrezGene:12402/Cbl
EntrezGene:12772/Ccr2
EntrezGene:16193/Il6
EntrezGene:19303/Pxn
EntrezGene:20411/Sorbs1
EntrezGene:21926/Tnf
EntrezGene:3569/IL6
EntrezGene:3684/ITGAM
EntrezGene:3815/KIT
EntrezGene:3952/LEP
EntrezGene:5054/SERPINE1
EntrezGene:56729/RETN
EntrezGene:5829/PXN
EntrezGene:6347/CCL2
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7412/VCAM1
EntrezGene:7462/LAT2
EntrezGene:867/CBL

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Ccl2 ENSMUSG00000035385 0,1
Il6 ENSMUSG00000025746 2,3
Tnf ENSMUSG00000024401 4,5
Lep ENSMUSG00000059201 6,7
Serpine1 ENSMUSG00000037411 8,9
Ppia ENSMUSG00000071866 10,11
Atp6v0d1 ENSMUSG00000013160 12,13

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
12, 13 chr8:108049342-108049548
10, 11 chr6:71591701-71591761
10, 11 chr6:123169066-123169130
10, 11 chr3:121959984-121960044
10, 11 chr4:105467160-105467220
10, 11 chr17:63920441-63920501
2, 3 chr5:30339955-30340055
10, 11 chr18:34206833-34206893
0, 1 chr11:81849115-81850486
10, 11 chr11:6319265-6319517
10, 11 chr14:30031163-30031223
10, 11 chr15:25769964-25770024
10, 11 chr7:18378261-18378321
6, 7 chr6:29020958-29021100
10, 11 chr9:96796415-96796475
10, 11 chr5:92235697-92235757
4, 5 chr17:35336821-35337121
10, 11 chr19:16238897-16238957
8, 9 chr5:137546968-137547161
10, 11 chr2:51726739-51726799

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2453617.S2.doc AGCACCAGCCAACTCTCAC
1 PMC2453617.S2.doc TCTGGACCCATTCCTTCTTG
2 PMC2453617.S2.doc GACAACCACGGCCTTCCCTA
3 PMC2453617.S2.doc GCCTCCGACTTGTGAAGTGGT
4 PMC2453617.S2.doc GGCAGGTCTACTTTGGAGTCATTGC
5 PMC2453617.S2.doc ACATTCGAGGCTCCAGTGAATTCGG
6 PMC2453617.S2.doc TGCTGCAGATAGCCAATGAC
7 PMC2453617.S2.doc GAGTAGAGTGAGGCTTCCAGGA
8 PMC2453617.S2.doc TCAGCCCTTGCTTGCCTCAT
9 PMC2453617.S2.doc GCATAGCCAGCACCGAGGA
10 PMC2453617.S2.doc ATCTGCACTGCCAAGACTGA
11 PMC2453617.S2.doc TTTCACCTTCCCAAAGACCA
12 PMC2453617.S2.doc TGATGCCATGTGTCCTATCC
13 PMC2453617.S2.doc CAGCTCTGTGCCGAAAGAGT
Display recognized sequences in FASTA format