text2genome

About us

Related Links

Press Coverage

PubMed: 17054774    PubMedCentral: PMC1636663

Expression of full-length p53 and its isoform Deltap53 in breast carcinomas in relation to mutation status and clinical parameters.

Baumbusch LO, Myhre S, Langerød A, Bergamaschi A, Geisler SB, Lønning PE, Deppert W, Dornreiter I, Børresen-Dale AL
Molecular cancer, 47 , 2006

Abstract:

BACKGROUND: The tumor suppressor gene p53 (TP53) controls numerous signaling pathways and is frequently mutated in human cancers. Novel p53 isoforms suggest alternative splicing as a regulatory feature of p53 activity. RESULTS: In this study we have analyzed mRNA expression of both wild-type and mutated p53 and its respective Deltap53 isoform in 88 tumor samples from breast cancer in relation to clinical parameters and molecular subgroups. Three-dimensional structure differences for the novel internally deleted p53 isoform Deltap53 have been predicted. We confirmed the expression of Deltap53 mRNA in tumors using quantitative real-time PCR technique. The mRNA expression levels of the two isoforms were strongly correlated in both wild-type and p53-mutated tumors, with the level of the Deltap53 isoform being approximately 1/3 of that of the full-length p53 mRNA. Patients expressing mutated full-length p53 and non-mutated (wild-type) Deltap53, "mutational hybrids", showed a slightly higher frequency of patients with distant metastasis at time of diagnosis compared to other patients with p53 mutations, but otherwise did not differ significantly in any other clinical parameter. Interestingly, the p53 wild-type tumors showed a wide range of mRNA expression of both p53 isoforms. Tumors with mRNA expression levels in the upper or lower quartile were significantly associated with grade and molecular subtypes. In tumors with missense or in frame mutations the mRNA expression levels of both isoforms were significantly elevated, and in tumors with nonsense, frame shift or splice mutations the mRNA levels were significantly reduced compared to those expressing wild-type p53. CONCLUSION: Expression of p53 is accompanied by the functionally different isoform Deltap53 at the mRNA level in cell lines and human breast tumors. Investigations of "mutational hybrid" patients highlighted that wild-type Deltap53 does not compensates for mutated p53, but rather may be associated with a worse prognosis. In tumors, both isoforms show strong correlations in different mutation-dependent mRNA expression patterns.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:5372/PMM1
EntrezGene:6161/RPL32
EntrezGene:7157/TP53
Genes found in fulltext (GNAT)
EntrezGene:1026/CDKN1A
EntrezGene:2064/ERBB2
EntrezGene:22059/Trp53
EntrezGene:2597/GAPDH
EntrezGene:3251/HPRT1
EntrezGene:4193/MDM2
EntrezGene:5372/PMM1
EntrezGene:6161/RPL32
EntrezGene:6426/SFRS1
EntrezGene:6908/TBP
EntrezGene:7157/TP53
EntrezGene:7462/LAT2

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TP53 ENSG00000141510 0,1,3,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28
PMM1 ENSG00000100417 4,5
RPL32 ENSG00000144713 6,7

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 3, 8, 9, 10, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 chr17:7572859-7590917
6, 7 chr3:12880997-12881669
6, 7 chr3:129115231-129115911
4, 5 chr22:41980035-41980334

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC1636663.pdf GGGAGAGGAGCTGGTGTTG
1 PMC1636663.pdf TGAGGTTGGCTCTGACTGTACC
2 PMC1636663.pdf CTCCATCCAGTGTGATGATGGT
3 PMC1636663.pdf GCAGGAACTGTTACACATG
4 PMC1636663.pdf ATCAACTTCTGCCTCAGCTACATG
5 PMC1636663.pdf CCATTCCGGAACTCGATGA
6 PMC1636663.pdf ACCAGTCAGACCGATATGTCAAAA
7 PMC1636663.pdf TTGTCAATGCCTCTGGGTTTC
8 PMC1636663.S1.pdf ACTTGTCATGGCGACTGTCCAGCTTTGTGCCAGGAGCCTCGCAGGGGTTGATGGGATTGGGGTTTTCCCCTCCCATGTGCTCAAGACTGGCGCTAAAAGTTTTGAGCTTCTCAAAAGTCTAGAGCCACCGTCCAGGGAGCAGGTAGCTGCTGGGCTCCGGGGACACTTTGCGTTCGGGCTGGGAGCGTGCTTTCCACGACGGTGACACGCTTCCCTGGATTGGCAGCCAGACTGCCTTCCGGGTCACTGCCATGGAGGAGCCGCAGTCAGATCCTAGCGTCGAGCCCCCTCTGAGTCAGG
9 PMC1636663.S1.pdf AAACATTTTCAGACCTATGGAAACTACTTCCTGAAAACAACGTTCTGTCCCCCTTGCCGT
10 PMC1636663.S1.pdf CCCAAGCAATGGATGATTTGATGCTGTCCCCGGACGATATTGAACAATGGTTCACTGAAG
11 PMC1636663.S1.pdf ACCCAGGTCCAGATGAAGCTCCCAGAATGCCAGAGGCTGCTCCCCCCGTGGCCCCTGCAC
12 PMC1636663.S1.pdf CAGCAGCTCCTACACCGGCGGCCCCTGCACCAGCCCCCTCCTGGCCCCTGTCATCTTCTG
13 PMC1636663.S1.pdf TCCCTTCCCAGAAAACCTACCAGGGCAGCTACGGTTTCCGTCTGGGCTTCTTGCATTCTG
14 PMC1636663.S1.pdf GGACAGCCAAGTCTGTGACTTGCACGTACTCCCCTGCCCTCAACAAGATGTTTTGCCAACGTA
15 PMC1636663.S1.pdf TGGCCAAGACCTGCCCTGTGCAGCTGTGGGTTGATTCCACACCCCCGCCCGGCACCCGCG
16 PMC1636663.S1.pdf TCCGCGCCATGGCCATCTACAAGCAGTCACAGCACATGACGGAGGTTGTGAGGCGCTGCC
17 PMC1636663.S1.pdf CCCACCATGAGCGCTGCTCAGATAGCGATGGTCTGGCCCCTCCTCAGCATCTTATCCGAG
18 PMC1636663.S1.pdf TGGAAGGAAATTTGCGTGTGGAGTATTTGGATGACAGAAACACTTTTCGACATAGTGTGG
19 PMC1636663.S1.pdf TGGTGCCCTATGAGCCGCCTGAGGTTGGCTCTGACTGTACCACCATCCACTACAACTACA
20 PMC1636663.S1.pdf TGTGTAACAGTTCCTGCATGGGCGGCATGAACCGGAGGCCCATCCTCACCATCATCACAC
21 PMC1636663.S1.pdf TGGAAGACTCCAGTGGTAATCTACTGGGACGGAACAGCTTTGAGGTGCGTGTTTGTGCCT
22 PMC1636663.S1.pdf GTCCTGGGAGAGACCGGCGCACAGAGGAAGAGAATCTCCGCAAGAAAGGGGAGCCTCACCC
23 PMC1636663.S1.pdf ACGAGCTGCCCCCAGGGAGCACTAAGCGAGCACTGCCCAACAACACCAGCTCCTCTCCCC
24 PMC1636663.S1.pdf AGCCAAAGAAGAAACCACTGGATGGAGAATATTTCACCCTTCAGATCCGTGGGCGTGAGC
25 PMC1636663.S1.pdf GCTTCGAGATGTTCCGAGAGCTGAATGAGGCCTTGGAACTCAAGGATGCCCAGGCTGGGA
26 PMC1636663.S1.pdf AGGAGCCAGGGGGGAGCAGGGCTCACTCCAGCCACCTGAAGTCCAAAAAGGGTCAGTCTA
27 PMC1636663.S1.pdf CCTCCCGCCATAAAAAACTCATGTTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCT
28 PMC1636663.S1.pdf CACTTCTTGTTCCCCACTGACAGCCTCCCACCCCCATCTCTCCCTCCCCTGCCATTTTGG
29 PMC1636663.S2.pdf CGTCATGGAAGACGTCATGAAAAACGTCATTGTTATCGGGGGCGTCCTcgggtAGGGGGTACTGCTGCTTCATGATTCGCCACATCACCTATTGTATCACCTACTGCTGCTACctcgGTGATGCGTCCTTACCACGAGTAGca
Display recognized sequences in FASTA format