text2genome

About us

Related Links

Press Coverage

PubMed: 8332472    PubMedCentral: PMC309616

Disruption in the AU motif of the mouse TNF-alpha 3' UTR correlates with reduced TNF production by macrophages in vitro.

Jacob CO, Tashman NB
Nucleic acids research, 2761 , 1993

Abstract:

Many cytokine mRNAs exhibit a conserved, AU-rich motif in the 3'-untranslated region (UTR) of the molecule. Such sequence elements have been implicated in the regulation of mRNA turnover and as potential translational regulators. We report on the identification of a 3 base pair insertion which disrupts the AU motif of the TNF-alpha gene in the NZW, B10.KPA44, SM/J and Mus spretus mice and an insertion of an 8 base pair sequence into the 3' AU motif of the IL-10 gene in the Mus Spretus mouse. The mutation in the AU motif of the TNF-alpha gene correlates with reduced production of this cytokine by peritoneal macrophages from these mouse strains.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:10249/GLYAT
EntrezGene:107146/Glyat
EntrezGene:14102/Fas
EntrezGene:16153/Il10
EntrezGene:16193/Il6
EntrezGene:21926/Tnf
EntrezGene:3133/HLA-E
EntrezGene:3133/HLA-E
EntrezGene:3133/HLA-E
EntrezGene:3439/IFNA1
EntrezGene:3569/IL6
EntrezGene:3586/IL10
EntrezGene:3664/IRF6
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:847/CAT
EntrezGene:929/CD14

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Tnf ENSMUSG00000024401 0,1,11,12
Il10 ENSMUSG00000016529 5,6,13,14

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
5, 6, 13, 14 chr1:132920948-132921201
0, 1 chr17:35336554-35336698
2 chr2:129125963-129125984
4 chr5:30346114-30346134

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC309616.txt AGCCTTCCTCACAGAGCCAG
1 PMC309616.txt GAAGACAGCTTCCCACACTG
2 PMC309616.txt CTACATCTTTCCTACCTCAGT
3 PMC309616.txt CGGACACTTCGAGTCTGTATA
4 PMC309616.txt GTGGACATTCCTCACTGTGG
5 PMC309616.txt CCTCGTTTGTACCTCTCTCC
6 PMC309616.txt GCCAGCCTTAGAATAGAAGC
7 PMC309616.txt CTCAAGCTTATCAGAGTGAAAGGAGAAGGC
8 PMC309616.txt CTCAAGCTTAGTGAAAGGGACAGAACCTGC
9 PMC309616.txt CTCAAGCTTTCATGTCTCCCCCCTTATGAC
10 PMC309616.txt CTCAAGCTTCTTGGGCCAGTGAGTGAA
11 PMC309616.txt AGCCTTCCTCACAGAGCCAGCCCCCCTCTATTTATATTTGCAC
12 PMC309616.txt TATTATTTATTTATTATTTATTTATTTGCTTATGAATGTATTTATTTGGAAGGCCGGGGTGTCCTGGAGGACCCAGTGTGGGAAGCTGTCTTC
13 PMC309616.txt CCTCGTTTGTACCTCTCTCCGAAATATTTATTACCTCTGATACCTCAGTTCCCATTCTATTTATTCACTGAGCTTCTCTGTGAACTATTTAGAAAGAAGCCCAATATTATAATTTTACAGTATTTATTATTTTTAACCTGTGTTT
14 PMC309616.txt CATTGGGGACACTTTATAGTATTTGATTAAAGGGAGATTATATTATATGATGGGAGGGGTTCTTCCTTGGGAAGCAATTGAAGCTTCTATCTAAGGCTGGCA
Display recognized sequences in FASTA format