text2genome

About us

Related Links

Press Coverage

PubMed: 19296835    PubMedCentral: PMC2688190

Oral phosphatidylcholine pretreatment alleviates the signs of experimental rheumatoid arthritis.

Eros G, Ibrahim S, Siebert N, Boros M, Vollmar B
Arthritis research & therapy, R43 , 2009

Abstract:

INTRODUCTION: Phosphatidylcholine and phosphatidylcholine-derived metabolites exhibit anti-inflammatory properties in various stress conditions. We hypothesized that dietary phosphatidylcholine may potentially function as an anti-inflammatory substance and may decrease inflammatory activation in a chronic murine model of rheumatoid arthritis (collagen-induced arthritis). METHODS: The experiments were performed on male DBA1/J mice. In groups 1 to 3 (n = 10 each), collagen-induced arthritis was induced by administration of bovine collagen II. In group 2 the animals were fed ad libitum with phosphatidylcholine-enriched diet as a pretreatment, while the animals of group 3 received this nourishment as a therapy, after the onset of the disease. The severity of the disease and inflammation-linked hyperalgesia were evaluated with semiquantitative scoring systems, while the venular leukocyte-endothelial cell interactions and functional capillary density were assessed by means of in vivo fluorescence microscopy of the synovial tissue. Additionally, the mRNA expressions of cannabinoid receptors 1 and 2, TNFalpha and endothelial and inducible nitric oxide synthase were determined, and classical histological analysis was performed. RESULTS: Phosphatidylcholine pretreatment reduced the collagen-induced arthritis-induced hypersensitivity, and decreased the number of leukocyte-endothelial cell interactions and the extent of functional capillary density as compared with those of group 1. It also ameliorated the tissue damage and decreased inducible nitric oxide synthase expression. The expressions of the cannabinoid receptors and TNFalpha were not influenced by the phosphatidylcholine intake. Phosphatidylcholine-enriched food administrated as therapy failed to evoke the aforementioned changes, apart from the reduction of the inducible nitric oxide synthase expression. CONCLUSIONS: Phosphatidylcholine-enriched food as pretreatment, but not as therapy, appears to exert beneficial effects on the morphological, functional and microcirculatory characteristics of chronic arthritis. We propose that oral phosphatidylcholine may be a preventive approach in ameliorating experimental rheumatoid arthritis-induced joint damage.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:18126/Nos2
EntrezGene:18127/Nos3
EntrezGene:228869/Ncoa5
EntrezGene:2597/GAPDH
EntrezGene:4846/NOS3
EntrezGene:788/SLC25A20
EntrezGene:847/CAT

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Tnf ENSMUSG00000024401 4,5

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
1 chr5:23877584-23877604
6 chr10:43540003-43541326
2 chr11:78758296-78758325
4, 5 chr17:35336821-35337121

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2688190.pdf AAGACAAGGCAGGGGTGGAA
1 PMC2688190.pdf GCAGGGGACAGGAAATAGTT
2 PMC2688190.pdf ACCCCTGTGTTCCACCAGGAGATGTTGAA
3 PMC2688190.pdf TGAAGCCATGACCCTTCGCATTAGCATGC
4 PMC2688190.pdf GGCAGGTCTACTTTGGAGTCATTGC
5 PMC2688190.pdf ACATTCGAGGCTCCAGTGAATTCGG
6 PMC2688190.pdf TCCACGACATACTCAGCAC
Display recognized sequences in FASTA format