text2genome

About us

Related Links

Press Coverage

PubMed: 19040745    PubMedCentral: PMC2647907

Immunomodulatory effects of recombinant BCG expressing pertussis toxin on TNF-alpha and IL-10 in a bladder cancer model.

Chade DC, Borra RC, Nascimento IP, Villanova FE, Leite LC, Andrade E, Srougi M, Ramos KL, Andrade PM
Journal of experimental & clinical cancer research : CR, 78 , 2008

Abstract:

BACKGROUND: Since successful treatment of superficial bladder cancer with BCG requires proper induction of Th1 immunity, we have developed a rBCG-S1PT strain that induced a stronger cellular immune response than BCG. This preclinical study was designed to compare the modulatory effects of BCG and rBCG-S1PT on bladder TNF-alpha and IL-10 expression and to evaluate antitumour activity. METHODS: For Experiment I, the MB49 bladder cancer cell line was used in C57BL/6 mice. Chemical cauterization of the bladder was performed to promote intravesical tumor implantation. Mice were treated by intravesical instillation with BCG, rBCG-S1PT or PBS once a week for four weeks. After 35 days the bladders were removed and weighed. TNF- and IL-10 cytokine responses were measured by qPCR. Experiment II was performed in the same manner as Experiment I, except the animals were not challenged with MB49 tumor cells. Results: rBCG-S1PT immunotherapy resulted in bladder weight reduction, compared to the BCG and control group. There were increases in TNF-alpha in the BCG-treated group, as well as increases in TNF-alpha and IL-10 mRNA in the rBCG-S1PT group. CONCLUSION: These data indicate a significant reduction of bladder tumor volume for the rBCG group, compared to the BCG and PBS groups. This suggests that rBCG could be a useful substitute for wild-type BCG and that the potential modulation between TNF-alpha and IL-10 cytokine productions may have therapeutic value.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:16153/Il10
EntrezGene:1630/DCC
EntrezGene:213/ALB
EntrezGene:21926/Tnf
EntrezGene:2597/GAPDH
EntrezGene:3558/IL2
EntrezGene:3586/IL10
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2
EntrezGene:717/C2

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Tnf ENSMUSG00000024401 0,1
Il10 ENSMUSG00000016529 2,3
Gapdh ENSMUSG00000057666 4,5

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
2, 3 chr1:132917914-132919112
4, 5 chr4:91518826-91518944
4, 5 chr3:69370823-69370941
4, 5 chr11:33176196-33176314
4, 5 chr15:12505059-12505177
0, 1 chr17:35337378-35337847
4, 5 chr19:16352679-16352797
4, 5 chr3:142625990-142626108
4, 5 chr11:20235482-20235600
4, 5 chr7:32437784-32437902
4, 5 chr2:43374384-43374502
4, 5 chr5:13042900-13043018
4, 5 chr11:26687048-26687166
4, 5 chrX:77439657-77439775
4, 5 chrX:85817858-85817976
4, 5 chrX:149838073-149838190
4, 5 chr8:95240293-95240411
4, 5 chr11:63126279-63126397
4, 5 chr4:83751220-83751338
4, 5 chr9:100525855-100525973
4, 5 chr8:60029514-60029632
4, 5 chr8:47340492-47340610
4, 5 chr15:84697159-84697277
4, 5 chr5:96291148-96291266
4, 5 chr7:33803819-33803937
4, 5 chr7:33144319-33144437
4, 5 chr7:59002482-59002600
4, 5 chr11:17874262-17874380
4, 5 chr15:8878618-8878735
4, 5 chr1:182257769-182257887
4, 5 chr3:139312758-139312876
4, 5 chr14:12113913-12114031
4, 5 chr7:33576920-33577038
4, 5 chr8:77929884-77930002
4, 5 chr7:34097534-34097652
4, 5 NT_166349:396837-396955
4, 5 chr5:28865525-28865643
4, 5 chr4:57384292-57384410
4, 5 chr12:50241665-50241787
4, 5 chr6:83824840-83824958
4, 5 chr5:106292187-106292305
4, 5 chr2:28789595-28789713

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2647907.pdf CATCTTCTCAAAATTCGAGTGACAA
1 PMC2647907.pdf TGGGAGTAGACAAGGTACAACCC
2 PMC2647907.pdf GGTTGCCAAGCCTTATCGGA
3 PMC2647907.pdf ACCTGCTCCACTGCCTTGCT
4 PMC2647907.pdf CAACTCACTCAAGATTGTCAGCAA
5 PMC2647907.pdf GGCATGGACTGTGGTCATGA
Display recognized sequences in FASTA format