text2genome

About us

Related Links

Press Coverage

PubMed: 11222770    PubMedCentral: PMC29712

Y box-binding protein-1 binds preferentially to single-stranded nucleic acids and exhibits 3'-->5' exonuclease activity.

Izumi H, Imamura T, Nagatani G, Ise T, Murakami T, Uramoto H, Torigoe T, Ishiguchi H, Yoshida Y, Nomoto M, Okamoto T, Uchiumi T, Kuwano M, Funa K, Kohno K
Nucleic acids research, 1200 , 2001

Abstract:

We have previously shown that Y box-binding protein-1 (YB-1) binds preferentially to cisplatin-modified Y box sequences. Based on structural and biochemical data, we predicted that this protein binds single-stranded nucleic acids. In the present study we confirmed the prediction and also discovered some unexpected functional features of YB-1. We found that the cold shock domain of the protein is necessary but not sufficient for double-stranded DNA binding while the C-tail domain interacts with both single-stranded DNA and RNA independently of the cold shock domain. In an in vitro translation system the C-tail domain of the protein inhibited translation but the cold shock domain did not. Both in vitro pull-down and in vivo co-immunoprecipitation assays revealed that YB-1 can form a homodimer. Deletion analysis mapped the C-tail domain of the protein as the region of homodimerization. We also characterized an intrinsic 3'-->5' DNA exonuclease activity of the protein. The region between residues 51 and 205 of its 324-amino acid extent is required for full exonuclease activity. Our findings suggest that YB-1 functions in regulating DNA/RNA transactions and that these actions involve different domains.

Organism/Genes in external databases

Datasource Data
Species found in fulltext (Linnaeus)
Homo sapiens
JC polyomavirus
Escherichia coli
Bos taurus
Oryctolagus cuniculus
Myxococcus xanthus
Gallus gallus
Mus musculus
Pyrobaculum aerophilum
Genes found in fulltext (GNAT)
EntrezGene:3146/HMGB1
EntrezGene:3815/KIT
EntrezGene:4904/YBX1
EntrezGene:5111/PCNA
EntrezGene:57120/GOPC
EntrezGene:5883/RAD9A
EntrezGene:7157/TP53
EntrezGene:8626/TP63

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TP53 ENSG00000141510 0,1

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
3 chr7:87230264-87230289
0, 1 chr17:7572913-7579914

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC29712.pdf CCATGGAGGAGCCGCAGTCAGATCC
1 PMC29712.pdf GAAGTGGAGAATGTCAGTCTGAGTCAGGCCC
2 PMC29712.pdf TCGATCGGGGCGGGGCGATCGGGGCGGGGCGA
3 PMC29712.pdf GGTGAGGCTGATTGGCTGGGCAGGA
4 PMC29712.pdf GATCTCGGGGCGGGGCGATCGGGGCGGGGCGA
5 PMC29712.pdf GATCTCGCCCCGCCCCGATCGCCCCGCCCCGA
Display recognized sequences in FASTA format