text2genome

About us

Related Links

Press Coverage

PubMed: 18507839    PubMedCentral: PMC2413210

Squamosamide derivative FLZ protects dopaminergic neurons against inflammation-mediated neurodegeneration through the inhibition of NADPH oxidase activity.

Zhang D, Hu X, Wei SJ, Liu J, Gao H, Qian L, Wilson B, Liu G, Hong JS
Journal of neuroinflammation, 21 , 2008

Abstract:

BACKGROUND: Inflammation plays an important role in the pathogenesis of Parkinson's disease (PD) through over-activation of microglia, which consequently causes the excessive production of proinflammatory and neurotoxic factors, and impacts surrounding neurons and eventually induces neurodegeneration. Hence, prevention of microglial over-activation has been shown to be a prime target for the development of therapeutic agents for inflammation-mediated neurodegenerative diseases. METHODS: For in vitro studies, mesencephalic neuron-glia cultures and reconstituted cultures were used to investigate the molecular mechanism by which FLZ, a squamosamide derivative, mediates anti-inflammatory and neuroprotective effects in both lipopolysaccharide-(LPS)- and 1-methyl-4-phenylpyridinium-(MPP+)-mediated models of PD. For in vivo studies, a 1-methyl-4-phenyl-1, 2, 3, 6-tetrahydropyridine-(MPTP-) induced PD mouse model was used. RESULTS: FLZ showed potent efficacy in protecting dopaminergic (DA) neurons against LPS-induced neurotoxicity, as shown in rat and mouse primary mesencephalic neuronal-glial cultures by DA uptake and tyrosine hydroxylase (TH) immunohistochemical results. The neuroprotective effect of FLZ was attributed to a reduction in LPS-induced microglial production of proinflammatory factors such as superoxide, tumor necrosis factor-alpha (TNF-alpha), nitric oxide (NO) and prostaglandin E2 (PGE2). Mechanistic studies revealed that the anti-inflammatory properties of FLZ were mediated through inhibition of NADPH oxidase (PHOX), the key microglial superoxide-producing enzyme. A critical role for PHOX in FLZ-elicited neuroprotection was further supported by the findings that 1) FLZ's protective effect was reduced in cultures from PHOX-/- mice, and 2) FLZ inhibited LPS-induced translocation of the cytosolic subunit of p47PHOX to the membrane and thus inhibited the activation of PHOX. The neuroprotective effect of FLZ demonstrated in primary neuronal-glial cultures was further substantiated by an in vivo study, which showed that FLZ significantly protected against MPTP-induced DA neuronal loss, microglial activation and behavioral changes. CONCLUSION: Taken together, our results clearly demonstrate that FLZ is effective in protecting against LPS- and MPTP-induced neurotoxicity, and the mechanism of this protection appears to be due, at least in part, to inhibition of PHOX activity and to prevention of microglial activation.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:13058/Cybb
EntrezGene:19255/Ptpn2
EntrezGene:21926/Tnf
EntrezGene:29430/HAP1_RAT

Best predicted genome from sequences: Rattus norvegicus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TNFA_RAT ENSRNOG00000000837 0,1
NOS2_RAT ENSRNOG00000011023 2,3
G3P_RAT ENSRNOG00000018630 6,7
NP_076455.1 ENSRNOG00000003622 8,9

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
6, 7 chr6:75176441-75176513
2, 3 chr10:65058305-65058383
6, 7 chrX:27911445-27911528
6, 7 chr8:105552739-105552822
6, 7 chr11:70680064-70680147
6, 7 chr17:94609133-94609216
6, 7 chr4:165675651-165675734
6, 7 chr5:8009008-8009091
7 chr18:63426578-63429410
6, 7 chrX:59155055-59155138
6, 7 chr10:103408165-103408248
6, 7 chr1:181632853-181632936
6, 7 chr1:44263870-44263953
6, 7 chr16:25751930-25752013
6, 7 chr10:70056621-70056704
6, 7 chr8:44322459-44322542
6, 7 chr8:116982807-116982890
6, 7 chr11:86596349-86596432
6, 7 chr2:231164130-231164213
6, 7 chr16:18713769-18713852
6, 7 chr6:6990471-6990554
6, 7 chr7:124293835-124293918
6, 7 chr3:146528341-146528424
6, 7 chr2:198211086-198211168
6, 7 chrX:134147392-134147475
6, 7 chr13:87367219-87367302
6, 7 chr15:92035325-92035408
6, 7 chr14:1949578-1949661
6, 7 chr18:64975758-64975841
6, 7 chr4:123558359-123558442
6 chr5:130543633-130544408
6, 7 chr7:10406487-10406570
6, 7 chr10:71195819-71195902
6, 7 chr10:79571931-79572014
6, 7 chr2:63229952-63230035
6, 7 chr11:73603668-73603751
6, 7 chr1:64750886-64750969
6, 7 chr5:73006425-73006508
6, 7 chr5:57060816-57060899
6, 7 chr6:37823737-37823820
6, 7 chr2:92763122-92763205
6, 7 chrX:121054041-121054124
6, 7 chr5:117081011-117081094
7 chr6:2256006-2268052
6, 7 chr10:25793780-25793863
2, 3 chr10:65111121-65111199
8, 9 chrX:25543794-25543862
6, 7 chr15:9217739-9217822
6, 7 chr15:84510823-84510906
6, 7 chr13:61675998-61676081
6, 7 chr2:155700780-155700863
6, 7 chr2:215917155-215917238
6, 7 chr2:191158060-191158143
1 chr20:3662486-3662509
6, 7 chr4:25140160-25140248
6, 7 chr10:55375376-55375459
6, 7 chr7:89762466-89762550
6, 7 chr14:385797-385880
6, 7 chr2:182359448-182359645
6, 7 chr14:43415553-43415636
6, 7 chr7:121242493-121242576

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2413210.pdf TCGTAGCAAACCACCAAGCA
1 PMC2413210.pdf CCCTTGAAGAGAACCTGGGAGTA
2 PMC2413210.pdf GTGCTAATGCGGAAGGTCATG
3 PMC2413210.pdf CGCTTCCGACTTTCCTGTCT
4 PMC2413210.pdf CCAGCAGGCTCATACTGATAGGA
5 PMC2413210.pdf GCAGGTCTGGGTCGAACTTG
6 PMC2413210.pdf CCTGGAGAAACCTGCCAAGTAT
7 PMC2413210.pdf AGCCCAGGATGCCCTTTAGT
8 PMC2413210.pdf CCTGCAGCCTGCCTGAATT
9 PMC2413210.pdf AAGGAGAGGAGATTCCGACACA
Display recognized sequences in FASTA format