text2genome

About us

Related Links

Press Coverage

PubMed: 19015308    PubMedCentral: PMC2585840

A point mutation in the murine Hem1 gene reveals an essential role for Hematopoietic protein 1 in lymphopoiesis and innate immunity.

Park H, Staehling-Hampton K, Appleby MW, Brunkow ME, Habib T, Zhang Y, Ramsdell F, Liggitt HD, Freie B, Tsang M, Carlson G, Friend S, Frevert C, Iritani BM
The Journal of experimental medicine, 2899 , 2008

Abstract:

Hem1 (Hematopoietic protein 1) is a hematopoietic cell-specific member of the Hem family of cytoplasmic adaptor proteins. Orthologues of Hem1 in Dictyostelium discoideum, Drosophila melanogaster, and Caenorhabditis elegans are essential for cytoskeletal reorganization, embryonic cell migration, and morphogenesis. However, the in vivo functions of mammalian Hem1 are not known. Using a chemical mutagenesis strategy in mice to identify novel genes involved in immune cell functions, we positionally cloned a nonsense mutation in the Hem1 gene. Hem1 deficiency results in defective F-actin polymerization and actin capping in lymphocytes and neutrophils caused by loss of the Rac-controlled actin-regulatory WAVE protein complex. T cell development is disrupted in Hem1-deficient mice at the CD4(-)CD8(-) (double negative) to CD4(+)CD8(+) (double positive) cell stages, whereas T cell activation and adhesion are impaired. Hem1-deficient neutrophils fail to migrate in response to chemotactic agents and are deficient in their ability to phagocytose bacteria. Remarkably, some Rac-dependent functions, such as Th1 differentiation and nuclear factor kappaB (NF-kappaB)-dependent transcription of proinflammatory cytokines proceed normally in Hem1-deficient mice, whereas the production of Th17 cells are enhanced. These results demonstrate that Hem1 is essential for hematopoietic cell development, function, and homeostasis by controlling a distinct pathway leading to cytoskeletal reorganization, whereas NF-kappaB-dependent transcription proceeds independently of Hem1 and F-actin polymerization.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:12515/Cd69
EntrezGene:16409/Itgam
EntrezGene:19264/Ptprc
EntrezGene:20208/Saa1
EntrezGene:20209/Saa2
EntrezGene:20210/Saa3
EntrezGene:20371/Foxp3
EntrezGene:50884/Nckap1
EntrezGene:105855/Nckap1l
EntrezGene:223927/BC048502

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Nckap1l ENSMUSG00000022488 0,2,3,35,36
Nckap1 ENSMUSG00000027002 4,5
Actb ENSMUSG00000029580 6,7
Il1b ENSMUSG00000027398 8,9
Il12a ENSMUSG00000027776 10,11
Tnf ENSMUSG00000024401 14,15
Cxcl1 ENSMUSG00000029380 16,17
Saa1 ENSMUSG00000074115 19,20
Saa2 ENSMUSG00000057465 21,22
Saa3 ENSMUSG00000040026 23,24
Abi1 ENSMUSG00000058835 25,26
Abi2 ENSMUSG00000026782 27,28
Wasf2 ENSMUSG00000028868 29,30
Cyfip1 ENSMUSG00000030447 31,32
Hprt1 ENSMUSG00000025630 33,34

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
8, 9 chr2:129193712-129193814
14, 15 chr17:35338050-35338693
29, 30 chr4:132741557-132745073
6, 7 chr5:143667339-143668361
20, 21, 22, 23 chr7:53970397-54009382
12 chr10:127734910-127734930
33, 34 chrX:50373309-50374499
10 chr3:68495960-68495980
25, 26 chr2:22816319-22817995
4, 5 chr2:80347005-80348953
31 chr7:63133124-63133148
0, 1, 2, 35, 36 chr15:103286297-103321392
17, 18 chr5:91320758-91333407

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2585840.pdf TGCAGAGCTTCTGTTCCTGTTGGA
1 PMC2585840.pdf AGAAGGAACTGCTGGCTACCCAAA
2 PMC2585840.S2.pdf AGGTGGCATGCCTACTCTTGATCT
3 PMC2585840.S2.pdf AGAGGCCACCACCAGAAACTCTTT
4 PMC2585840.S2.pdf AATGTGTATGAGCTGTCCTCGGCT
5 PMC2585840.S2.pdf TACATTGCTGGCCAGTGTAGGCAA
6 PMC2585840.S2.pdf TCCTTCGTTGCCGGTCCAC
7 PMC2585840.S2.pdf ACCAGCGCAGCGATATCGTC
8 PMC2585840.S2.pdf CTTCAGGCAGGCAGTATCACTCAT
9 PMC2585840.S2.pdf AAGAAGGTGCTCATGTCCTCATCC
10 PMC2585840.S2.pdf CACCCTTGCCCTCCTAAACC
11 PMC2585840.S2.pdf CAAGGCACAGGGTCATCATC
12 PMC2585840.S2.pdf CCAGCAGCTCTCTCGGAATC
13 PMC2585840.S2.pdf TCATATGTCCCGCTGGTGC
14 PMC2585840.S2.pdf ATGTCTCAGCCTCTTCTCATTCCTGC
15 PMC2585840.S2.pdf AGAACTGATGAGAGGGAGGCCATTTG
16 PMC2585840.S2.pdf ACCCAAACCGAAGTCATAGCC
17 PMC2585840.S2.pdf TTCAGGGTCAAGGCAAGCC
18 PMC2585840.S2.pdf TTTTTGACCGCCCTTGAGAG
19 PMC2585840.S2.pdf CATTTGTTCACGAGGCTTTCCAAGGG
20 PMC2585840.S2.pdf TTCCTGAAAGGCCTCTCTTCCATCAC
21 PMC2585840.S2.pdf AGCTGGCTGGAAAGATGGAGACAA
22 PMC2585840.S2.pdf TGTCCTCTGCCGAAGAATTCCTGA
23 PMC2585840.S2.pdf ACAGCCAAAGATGGGTCCAGTTCA
24 PMC2585840.S2.pdf ATCGCTGATGACTTTAGCAGCCCA
25 PMC2585840.S2.pdf TGGCACATTGTCGAGAACAAACCC
26 PMC2585840.S2.pdf ACTGTTGGAGGCTTAACAGGCTCT
27 PMC2585840.S2.pdf ATCGAACTTACAGCAGCAGTGGGA
28 PMC2585840.S2.pdf AACAGGATGACCTGGAAAGACGCT
29 PMC2585840.S2.pdf ACCACCCAAGACCAGAAGCTC
30 PMC2585840.S2.pdf TCCTGCAGCATCTTCTCCTTCCAA
31 PMC2585840.S2.pdf ATGTTCCTGGCCAACCACAACAAG
32 PMC2585840.S2.pdf AGGTACAGGCCAAATCCCATGACT
33 PMC2585840.S2.pdf GTTGGATACAGGCCAGACTTTGTTG
34 PMC2585840.S2.pdf GAGGGTAGGCTGGCCTATAGGCT
35 PMC2585840.S2.pdf AGCTGAGATAATTAGATTCCTCACT
36 PMC2585840.S2.pdf AGTGAGGAATCTAATTATCTCAGCTTT
Display recognized sequences in FASTA format