text2genome

About us

Related Links

Press Coverage

PubMed: 6379601    PubMedCentral: PMC320018

Cloning and expression analysis of full length mouse cDNA sequences encoding the transformation associated protein p53.

Jenkins JR, Rudge K, Redmond S, Wade-Evans A
Nucleic acids research, 5609 , 1984

Abstract:

We have cloned and sequenced overlapping cDNA fragments which together encode the entire mouse protein p53. Using these cDNA's we have reconstructed the full length coding region for the protein, and have analysed its coding potential by expression in vitro, both as a full length sequence and as a subfragment contained in a fusion protein. The predicted amino acid sequence contains no obvious homologies to any known oncogenes but includes a possible tyrosine kinase acceptor site.

Organism/Genes in external databases

Datasource Data
Annotations in NCBI Entrez Genes
EntrezGene:22059/Trp53
Genes found in fulltext (GNAT)
EntrezGene:22059/Trp53

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Trp53 ENSMUSG00000059552 0,1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
20 chr17:54560032-54560086
1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 14, 16, 17, 18, 19, 21, 22 chr11:69400401-69404973

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC320018.txt GGAATTCCGGAATTCCGGAATTCCATCCTGGCTGTAGGTAGCGACTACAGTTAGGGGGCACCTAGCATTCAGGCCCTCATCCTCCTCCTTCCCAGCAGGGTGTCACGCTTCTCCGAAGCTGGATGACTGCC
1 PMC320018.txt ATGGAGGAGTCACAGTCGGATATCAGCCTCGAGCTCCCTCTGAGCCAGGAGACA
2 PMC320018.txt TTTTCAGGCTTATGGAAACTACTTCCTCCAGAAGATATCCTGCCATCACCTCAC
3 PMC320018.txt TGCATGGACGATCTGTTGCTGCCCCGAGATGTTGAGGAGTTTTTTGAAGGCCCA
4 PMC320018.txt AGTGAAGCCCTCCGAGTGTCAGGAGCTCCTGCAGCACAGGACCCTGTCACCGAG
5 PMC320018.txt ACCCCTGGCCAGTGGCCTGCCCCAGCCACTCCATGGCCCCTGTCATCTTTTGTC
6 PMC320018.txt CCTTCTCAAAAAACTTACCAGGGCAACTATGGCTTCCACCTGGGCTTCCTGCAG
7 PMC320018.txt GGGACAGCCAAGTCTGTTATGTGCACGTACTCTCCTCCCCTCAATAAGCTA
8 PMC320018.txt TTCTGCCAGCTGGCGAAGACGTGCCCTGTGCAGTTGTGGGTCAGCGCCACACCT
9 PMC320018.txt CCAGCTGGGAGCCGTGTCCGCGCCATGGCCATCTACAAGAAGTCACAGCACATG
10 PMC320018.txt ACGGAGGTCGTGAGACGCTGCCCCCACCATGAGCGCTGCTCCGATGGTGATGGC
11 PMC320018.txt CTGGCTCCTCCCCAGCATCTTATCCGGGTGGAAGGAAATTTGTATCCCGAGTAT
12 PMC320018.txt CTGGAAGACAGGCAGACTTTTCGCCACAGCGTGGTGGTACCTTATGAGCCACCC
13 PMC320018.txt GAGGCCGGCTCTGAGTATACCACCATCCACTACAAGTACATGTGTAATAGCTCC
14 PMC320018.txt TGCATGGGGGGCATGAACCGCCGACCTATCCTTACCATCATCACACTGGAAGAC
15 PMC320018.txt TCCAGTGGGAACCTTCTGGGACGGGACAGCTTTGAGGTTCGTGTTTGTGCCTGC
16 PMC320018.txt CCTGGGAGAGACCGCCGTACAGAAGAAGAAAATTTCCGCAAAAAGGAAGTCCTT
17 PMC320018.txt TGCCCTGAACTGCCCCCAGGGAGCGCAAAGAGAGCGCTGCCCACCTGCACAAGC
18 PMC320018.txt GCCTCTCCCCCGCAAAAGAAAAAACCACTTGATGGAGAGTATTTCACCCTCAAG
19 PMC320018.txt ATCCGCGGGCGTAAACGCTTCGAGATGTTCCGGGAGCTGAATGAGGCCTTAGAG
20 PMC320018.txt TTAAAGGATGCCCATGCTACAGAGGAGTCTGGAGACAGCAGGGCTCACTCCAGC
21 PMC320018.txt TACCTGAAGACCAAGAAGGGCCAGTCTACTTCCCGCCATAAAAAAACAATGGTC
22 PMC320018.txt AAGAAAGTGGGGCCTGACTCAGACTGACTGCCTCTGCATCCCGTCCCCATCACCAGCCTCCCCCTCT
Display recognized sequences in FASTA format