text2genome

About us

Related Links

Press Coverage

PubMed: 17425404    PubMedCentral: PMC1851623

TREM2-transduced myeloid precursors mediate nervous tissue debris clearance and facilitate recovery in an animal model of multiple sclerosis.

Takahashi K, Prinz M, Stagi M, Chechneva O, Neumann H
PLoS medicine, , 2007

Abstract:

BACKGROUND: In multiple sclerosis, inflammation can successfully be prevented, while promoting repair is still a major challenge. Microglial cells, the resident phagocytes of the central nervous system (CNS), are hematopoietic-derived myeloid cells and express the triggering receptor expressed on myeloid cells 2 (TREM2), an innate immune receptor. Myeloid cells are an accessible source for ex vivo gene therapy. We investigated whether myeloid precursor cells genetically modified to express TREM2 affect the disease course of experimental autoimmune encephalomyelitis (EAE), an animal model of multiple sclerosis. METHODS AND FINDINGS: EAE was induced in mice by immunization with a myelin autoantigen. Intravenous application of TREM2-transduced bone marrow-derived myeloid precursor cells at the EAE peak led to an amelioration of clinical symptoms, reduction in axonal damage, and prevention of further demyelination. TREM2-transduced myeloid cells applied intravenously migrated into the inflammatory spinal cord lesions of EAE-diseased mice, showed increased lysosomal and phagocytic activity, cleared degenerated myelin, and created an anti-inflammatory cytokine milieu within the CNS. CONCLUSIONS: Intravenously applied bone marrow-derived and TREM2-tranduced myeloid precursor cells limit tissue destruction and facilitate repair within the murine CNS by clearance of cellular debris during EAE. TREM2 is a new attractive target for promotion of repair and resolution of inflammation in multiple sclerosis and other neuroinflammatory diseases.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:11820/App
EntrezGene:1236/CCR7
EntrezGene:16153/Il10
EntrezGene:16784/Lamp2
EntrezGene:17196/Mbp
EntrezGene:17880/Myh11
EntrezGene:18591/Pdgfb
EntrezGene:2048/EPHB2
EntrezGene:22177/Tyrobp
EntrezGene:24547/MBP_RAT
EntrezGene:24699/CD45_RAT
EntrezGene:24944/LAMP2_RAT
EntrezGene:2597/GAPDH
EntrezGene:351/APP
EntrezGene:3565/IL4
EntrezGene:3586/IL10
EntrezGene:3684/ITGAM
EntrezGene:3815/KIT
EntrezGene:3920/LAMP2
EntrezGene:4155/MBP
EntrezGene:4843/NOS2
EntrezGene:5362/PLXNA2
EntrezGene:54209/TREM2
EntrezGene:54226/A4_RAT
EntrezGene:5788/PTPRC
EntrezGene:7305/TYROBP
EntrezGene:83433/Trem2
EntrezGene:8842/PROM1
EntrezGene:920/CD4
EntrezGene:941/CD80
EntrezGene:942/CD86
EntrezGene:948/CD36

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Gapdh ENSMUSG00000057666 1,6,7,0
Trem2 ENSMUSG00000023992 2,3
Tyrobp ENSMUSG00000030579 4,5
Tnf ENSMUSG00000024401 8,9
Il1b ENSMUSG00000027398 10,11
Nos2 ENSMUSG00000020826 12,13
Tgfb1 ENSMUSG00000002603 14,15
Il10 ENSMUSG00000016529 16,17
Ifng ENSMUSG00000055170 18,19
Il12b ENSMUSG00000004296 20,21
Il12a ENSMUSG00000027776 22,23
Il2 ENSMUSG00000027720 24,25
Il4 ENSMUSG00000000869 26,27
Bdnf ENSMUSG00000048482 28,29
Ntf3 ENSMUSG00000049107 30,31
Gdnf ENSMUSG00000022144 32,33

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 1, 6, 7 chr2:28789414-28789986
0, 1, 6, 7 chr3:139312485-139313057
17 chr1:132919088-132919109
20, 21 chr11:44223689-44223740
30, 31 chr6:126051980-126052031
22, 23 chr3:68501886-68501949
0, 1, 6, 7 chr15:12504786-12505358
0, 1, 6, 7 chr7:59002209-59002781
0, 1, 6, 7 chr5:96290875-96291447
14, 15 chr7:26489193-26489244
28, 29 chr2:109564168-109564219
8, 9 chr17:35337273-35337328
32, 33 chr15:7784544-7784595
0, 1, 6, 7 chr6:125112530-125113334
10, 11 chr2:129192995-129193055
18, 19 chr10:117878225-117878277
0, 1, 6, 7 chr5:106292006-106292578
0, 1, 6, 7 chr4:91518645-91519217
0, 1, 6, 7 chr3:121933399-121933971
26, 27 chr11:53431991-53432042
13 chr11:78770935-78770956
0, 1, 6, 7 chr6:128152535-128153108
0, 1, 6, 7 chr2:11330943-11331515
0, 1, 6, 7 chr11:26686775-26687347
2 chr17:48485880-48485900
4, 5 chr7:31198857-31202428
0, 1, 6, 7 chrX:77439476-77440048

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC1851623.S5.doc AACTTTGGCATTGTGGAAGG
1 PMC1851623.S5.doc ACACATTGGGGGTAGGAACA
2 PMC1851623.S5.doc ATGGGACCTCTCCACCAGTT
3 PMC1851623.S5.doc TCACGTACCTCCGGGTCCA
4 PMC1851623.S5.doc ATGGGGGCTCTGGAGCCCT
5 PMC1851623.S5.doc TCATCTGTAATATTGCCTCTGTGT
6 PMC1851623.S5.doc CTCCACTCACGGCAAATTCAA
7 PMC1851623.S5.doc GATGACAAGCTTCCCATTCTCG
8 PMC1851623.S5.doc CCGTCAGCCGATTTGCTATCT
9 PMC1851623.S5.doc ACGGCAGAGAGGAGGTTGACTT
10 PMC1851623.S5.doc ACAACAAAAAAGCCTCGTGCTG
11 PMC1851623.S5.doc CCATTGAGGTGGAGAGCTTTCA
12 PMC1851623.S5.doc GGCAAACCCAAGGTCTACGTTC
13 PMC1851623.S5.doc TACCTCATTGGCCAGCTGCTT
14 PMC1851623.S5.doc AGGACCTGGGTTGGAAGTGG
15 PMC1851623.S5.doc AGTTGGCATGGTAGCCCTTG
16 PMC1851623.S5.doc AGGCGCTGTCATCGATTTCTC
17 PMC1851623.S5.doc TGCTCCACTGCCTTGCTCTTA
18 PMC1851623.S5.doc TGCATCTTGGCTTTGCAGC
19 PMC1851623.S5.doc GGCAGTAACAGCCAGAAACAGC
20 PMC1851623.S5.doc TCACACTGGACCAAAGGGACT
21 PMC1851623.S5.doc CCTCCTGGCAGGACACTGAA
22 PMC1851623.S5.doc AAATGAAGCTCTGCATCCTGC
23 PMC1851623.S5.doc TCACCCTGTTGATGGTCACG
24 PMC1851623.S5.doc GTCAACAGCGCACCCACTT
25 PMC1851623.S5.doc TGCTTCCGCTGTAGAGCTTG
26 PMC1851623.S5.doc CACGGATGCGACAAAAATCA
27 PMC1851623.S5.doc CTCGTTCAAAATGCCGATGA
28 PMC1851623.S5.doc AGGCACTGGAACTCGCAATG
29 PMC1851623.S5.doc AAGGGCCCGAACATACGATT
30 PMC1851623.S5.doc TCCTCAGCCATTGACATTCG
31 PMC1851623.S5.doc GATCTCCCCCAGCACTGTGA
32 PMC1851623.S5.doc GGGTGCGTTTTAACTGCCAT
33 PMC1851623.S5.doc GCCCAAACCCAAGTCAGTGA
Display recognized sequences in FASTA format