text2genome

About us

Related Links

Press Coverage

PubMed: 7731809    PubMedCentral: PMC306791

Single base discrimination for ribonuclease H-dependent antisense effects within intact human leukaemia cells.

Giles RV, Ruddell CJ, Spiller DG, Green JA, Tidd DM
Nucleic acids research, 954 , 1995

Abstract:

We have previously demonstrated, in vitro, that phosphodiester and phosphorothioate antisense oligodeoxynucleotides could direct ribonuclease H to cleave non-target RNA sites and that chimeric methylphosphonodiester/phosphodiester analogue structures were substantially more specific. In this report we show that such chimeric molecules can promote point mutation-specific scission of target mRNA by both Escherichia coli and human RNases H in vitro. Intact human leukaemia cells 'biochemically microinjected' with antisense effectors demonstrated efficient suppression of target mRNA expression. It was noted that the chimeric methylphosphonodiester/phosphodiester structures showed single base discrimination, whereas neither the phosphodiester nor phosphorothioate compounds were as stringent. Finally, we show that the antisense effects obtained in intact cells were due to endogenous RNase H activity.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:150465/TTL
EntrezGene:2064/ERBB2
EntrezGene:246243/RNASEH1
EntrezGene:4609/MYC
EntrezGene:6714/SRC
EntrezGene:7157/TP53

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TP53 ENSG00000141510 0,6,7,8

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 6, 8 chr17:7574011-7577130

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC306791.txt TTTGAGGTGcGtGTTTGTGCC
1 PMC306791.txt TTTGAGGTGcATGTTTGTGCC
2 PMC306791.txt TTGCGGAGATTCTCTTCCTCCTCTT
3 PMC306791.txt GGTACCTAATACGACTCACTATAGGGAGAAGCTTAACGGTGACACGCTTCCCTGGATT
4 PMC306791.txt AGAGAGGGATCCAAGGGAACAAGAAGTGGAGAAT
5 PMC306791.txt GGGCATAGGCTGACCCTCGCTGAA
6 PMC306791.txt CGAAGCGCTCACGCCCACGGAT
7 PMC306791.txt TGGGCAGTGCTCGCTTAGTGC
8 PMC306791.txt TTGCGGAGATTCTCTTCCTCT
9 PMC306791.txt TTGCGGAGATTCTCTTCCTCT
Display recognized sequences in FASTA format