text2genome

About us

Related Links

Press Coverage

PubMed: 18079988    PubMedCentral: PMC2134920

Prognostic Values of microRNAs in Colorectal Cancer.

Xi Y, Formentini A, Chien M, Weir DB, Russo JJ, Ju J, Kornmann M, Ju J
Biomarker insights, 113 , 2006

Abstract:

The functions of non-coding microRNAs (miRNAs) in tumorigenesis are just beginning to emerge. Previous studies from our laboratory have identified a number of miRNAs that were deregulated in colon cancer cell lines due to the deletion of the p53 tumor suppressor gene. In this study, the in vivo significance of some of these miRNAs was further evaluated using colorectal clinical samples. Ten miRNAs (hsa-let-7b, hsa-let-7g, hsa-miR-15b, hsa-miR-181b, hsa-miR-191, hsa-miR-200c, hsa-miR-26a, hsa-miR-27a, hsa-miR-30a-5p and hsa-miR-30c) were evaluated for their potential prognostic value in colorectal cancer patients. Forty eight snap frozen clinical colorectal samples (24 colorectal cancer and 24 paired normal patient samples) with detailed clinical follow-up information were selected. The expression levels of 10 miRNAs were quantified via qRT-PCR analysis. The statistical significance of these markers for disease prognosis was evaluated using a two tailed paired Wilcoxon test. A Kaplan-Meier survival curve was generated followed by performing a Logrank test. Among the ten miRNAs, hsa-miR-15b (p = 0.0278), hsa-miR-181b (p = 0.0002), hsa-miR-191 (p = 0.0264) and hsa-miR-200c (p = 0.0017) were significantly over-expressed in tumors compared to normal colorectal samples. Kaplan-Meier survival analysis indicated that hsa-miR-200c was significantly associated with patient survival (p = 0.0122). The patients (n = 15) with higher hsa-miR-200c expression had a shorter survival time (median survival = 26 months) compared to patients (n = 9) with lower expression (median survival = 38 months). Sequencing analysis revealed that hsa-miR-181b (p = 0.0098) and hsa-miR-200c (p = 0.0322) expression were strongly associated with the mutation status of the p53 tumor suppressor gene. Some of these miRNAs may function as oncogenes due to their over-expression in tumors. hsa-miR-200c may be a potential novel prognostic factor in colorectal cancer.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:1875/E2F5
EntrezGene:1977/EIF4E
EntrezGene:1984/EIF5A
EntrezGene:3815/KIT
EntrezGene:4215/MAP3K3
EntrezGene:4609/MYC
EntrezGene:7157/TP53
EntrezGene:83881/MIXL1

Best predicted genome from sequences: Homo sapiens

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
TP53 ENSG00000141510 2,3,4,5,6

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
2, 3, 4, 5, 6 chr17:7577129-7590803

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2134920.pdf GTCGTTGATCGCCATATCGTGGGCGGCCCTCGA
1 PMC2134920.pdf TTCGATCAGCGTACCGTGGAGAGCAGCCTTCGATGA
2 PMC2134920.pdf AAGTCTAGAGCCACCGTCCA
3 PMC2134920.pdf TCTGGGAAGGGACAGAAGA
4 PMC2134920.pdf GAAGACCCAGGTCCAGATGA
5 PMC2134920.pdf AGCTGTTCCGTCCCAGTAGA
6 PMC2134920.pdf CCATCCTCACCATCATCACA
7 PMC2134920.pdf GCAAGCAAGGGTTCAAAGACa
Display recognized sequences in FASTA format