text2genome

About us

Related Links

Press Coverage

PubMed: 19784377    PubMedCentral: PMC2747021

Synergistic antibacterial and anti-inflammatory activity of temporin A and modified temporin B in vivo.

Capparelli R, Romanelli A, Iannaccone M, Nocerino N, Ripa R, Pensato S, Pedone C, Iannelli D
PloS one, , 2009

Abstract:

Temporins are antimicrobial peptides secreted by the granular glands of the European red frog (Rana temporaria). They are 10-14 amino acid long polypeptides active prevalently against gram positive bacteria. This study shows that a synthetic temporin B analogue (TB-YK), acquires the capacity to act in synergism with temporin A and to exert antimicrobial and anti-inflammatory activity in vivo against gram positive and gram negative bacteria. Administration of 3.4 mg/Kg of temporin A (TA)+1.6 mg/Kg TB-YK, given to individual mice concurrently with a lethal dose of bacteria (gram positive or negative), rescued 100% of the animals. More importantly, the same doses of temporins, administered one week after experimental infection with a sub lethal dose of bacteria, sterilized 100% of the animals within 3-6 days. Also, it is described an animal model based on the use of sub lethal doses of bacteria, which closely mimics bacterial infection in humans. The model offers the possibility to test in a preclinical setting the true potential of TA and TB-YK in combination as antimicrobial and anti-inflammatory agents.

Organism/Genes in external databases

Datasource Data
Genes found in fulltext (GNAT)
EntrezGene:14603/Gif
EntrezGene:16189/Il4
EntrezGene:16193/Il6
EntrezGene:21926/Tnf
EntrezGene:2597/GAPDH
EntrezGene:3439/IFNA1
EntrezGene:3565/IL4
EntrezGene:3569/IL6
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:7124/TNF
EntrezGene:8161/COIL

Best predicted genome from sequences: Mus musculus

Best predicted genes based on DNA sequences found in paper:

Symbol Ensembl Sequences
Gapdh ENSMUSG00000057666 0,1
Il6 ENSMUSG00000025746 2,3
Tnf ENSMUSG00000024401 4,5
Il4 ENSMUSG00000000869 6,7
Ifng ENSMUSG00000055170 8,9

Genome Annotation: Links to best and chained genome matches

SeqNo Coordinate Range
0, 1 chr8:60029395-60029632
8, 9 chr10:117882620-117882867
0, 1 chr5:106292187-106292424
0, 1 chr2:162808458-162808694
0, 1 chr11:17874262-17874499
0, 1 chr2:28789595-28789832
0, 1 chr7:32664361-32664597
0, 1 chr8:95240293-95240530
0, 1 chr6:83824840-83825077
0, 1 chr14:12113913-12114150
0, 1 chr1:182257769-182258006
0, 1 chr3:69370823-69371060
0, 1 NT_166349:396718-396955
0, 1 chr4:83751101-83751338
0, 1 chr11:63126279-63126516
0, 1 chrX:12903613-12903843
0, 1 chr9:100525855-100526096
0, 1 chrX:85817858-85818095
0, 1 chr2:16900915-16901155
0, 1 chr3:121933580-121933817
0, 1 chr2:104132027-104132264
0, 1 chr7:59002363-59002600
0, 1 chr8:47340492-47340729
0, 1 chr5:28865406-28865643
0, 1 chr15:8878618-8878854
0, 1 chr3:139312639-139312876
0, 1 chr4:91518826-91519063
0, 1 chr5:13042900-13043137
0, 1 chr6:86235183-86235419
0, 1 chr2:43374384-43374621
3 chr5:30341453-30341474
0, 1 chr8:77929884-77930121
0, 1 chr7:33390136-33390372
0, 1 chr11:26686929-26687166
0, 1 chr19:16352560-16352797
0, 1 chr11:20235482-20235719
0, 1 chr5:96291029-96291266
0, 1 chr3:142625871-142626108
0, 1 chr15:12504940-12505177
4, 5 chr17:35338039-35338690
6 chr11:53432039-53432062
0, 1 chr4:57384292-57384529
0, 1 chrX:77439657-77439894

Recognized sequences in fulltext

SeqNo file name Recognized DNA
0 PMC2747021.pdf TTCACCACCATGGAGAAGGC
1 PMC2747021.pdf GGCATGGACTGTGGTCATGA
2 PMC2747021.pdf AAAGAGTTGTGCAATGGCAATT
3 PMC2747021.pdf CAGTTTGGTAGCATCCATCAT
4 PMC2747021.pdf TCTCAGCCTCTTCTCATTCCT
5 PMC2747021.pdf GTCTGGGCCATAGAACTGATG
6 PMC2747021.pdf AATGTACCAGGAGCCATATCCAC
7 PMC2747021.pdf TCACTCTCTGTGGTGTTCTTCGT
8 PMC2747021.pdf AGCGGCTGACTGAACTCAGATTGTAG
9 PMC2747021.pdf GTCACAGTTTTCAGCTGTATAGGG
Display recognized sequences in FASTA format