text2genome

About us

Related Links

Press Coverage

Accessing text2genome from your programs

If you want to import the data in text2genome into your own programs, issue a HTTP GET request in a format similar to this:
http://text2genome.smith.man.ac.uk/inspector.cgi?pmcId=XXXX&format=xml
or this
http://text2genome.smith.man.ac.uk/inspector.cgi?pmid=XXXX&format=xml
The XML file returned will include tags that are a subset of the following ones:
<text2genome>
    <article pmcId="2292257">
    <sequence id="0">CGTGTTCCTACCCCCAATGT</sequence>
    <sequence id="1">TGTCATCATACTTGGCAGGTTTCT</sequence>
    <sequence id="2">GAATTGTACCGCAGCTTCAAAA</sequence>
    <bestGenomeTaxonId>10090</bestGenomeTaxonId>
    <bestGenomeName>Mus musculus</bestGenomeName>
    <bestGene symbol="Cd44">ENSMUSG00000005087</bestGene>
    <bestGene symbol="Lhx2">ENSMUSG00000000247</bestGene>
    <bestGene symbol="Nkx2-5">ENSMUSG00000015579</bestGene>
    <chainedLink url="http://www.ensembl.org/Homo_sapiens/Location/View?r=21:33040892-33041163;contigviewbottom=das:http://max.smith.man.ac.uk/t2g/das/Homo_sapiens.GRCh37.reference_final=labels">7/8/9</chainedLink>
    <article>
</text2genome>

Do not hesitate to contact maximilianh@gmail.com if you need additional fields in the XML output or for any other question.